Transcript asmbl_17733

Sequence
Transcript Sequence for observation asmbl_17733 of TGE0003927:
GCTTCCCCTCTTCCACGACATGTGCGCCGCTCAGCTGACGGCGGCCGCGGCGGCCGCGCAGGCGGCTGCGGCCCCGGGCTCCGTGTATGCCTACTCCGCGCGCCCGCTGGCGGGCGGGGAGCCCGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTGGCGTCGCTCTGAGGCACAACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCGGCGCCTCGGGCCCCGGGGTCTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTCGGGCATCAGGAAAACACCAAAAACGAAGAGATCCTGAATTCTCTCAAGTACGTCCGACCTGGCGGCGGGTTCGAGCCCAACTTCACGCTCTTCGAGAAGTGCGACGTGAACGGCGCACAGGCGCACCCGCTCTTCACCTTCTTGAGGGAGGCTCTGCCGGCGCCCAGTGACGACACCACCGCGCTAATGACCGATCCCAAGTTCATCATCTGGTCTCCGGTATGCCGCAACGACATTGCCTGGAACTTCGAGAAGTTCCTGGTGGGCCGGGACGGCGTTCCTGTGCGCAGATACAGCCGCCGCTTCCCGACCATCGACATCGAGCCCGACATCGAAGCCCTGCTGTCCCAGGGGCCTAGCAGTGCCTAGGGCACCCCTGCTGCCTCTGCTTCTTGGCAGACACAGCGCTGCCCTCCGGGGGTTTTATCCATGATGGTGTTTCCGCTAAACCTGCAAGGAGGTACACCTGATGTCCAGGAAAATCCCCTGGGGTGGGCGCTGGGCCTGACCATCACAGCCTCTCCCTCCCACACCGCCACCCCTCTCAATAAAGTGTCCTGTCAGCAG