Transcript asmbl_30199

Sequence
Transcript Sequence for observation asmbl_30199 of TGE0056497:
GTGAGCAACCTCCGCCTGCTCGCCGGACGCTTCCAGTCCCTCCCCCAAACCCCTTGCCCTGTCCCCGCGCCCCTCCACGGGCCTAGCATTTCCTCTGAGCAGCGGCCTGGCCTGATCACCACCCATCTCCCCACAGTGGAAGGCGGGCACAGAGCCATCTTCTTCAATCGGATCGGTGGAGTGCAGCAGGACACTATCCTGGCCGAGGGCCTTCACTTCAGGATCCCTTGGTTCCAGTACCCCATTATCTATGACATTCGGGCCAGACCTCGAAAAATCTCCTCCCCTACAGGCTCCAAAGACCTACAGATGGTGAATATCTCCCTGCGAGTGTTGTCTCGACCCAATGCTCAGGAGCTTCCTAGCATGTACCAGCGCCTAGGGCTGGACTACGAGGAACGAGTGTTGCCGTCCATTGTCAACGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCACAGCTGATCACCCAGCGGGCCCAGGTATCCCTGTTGATCCGCCGGGAGCTGACAGAGAGGGCCAAGGACTTCAGCCTCATCCTGGATGATGTGGCCATCACAGAGCTGAGCTTTAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAACAAGTGGCCCAGCAGGAGGCCCAGCGGGCCCAATTCTTGGTAGAAAAAGCAAAGCAGGAACAGCGGCAGAAAATTGTGCAGGCCGAGGGTGAGGCCGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAACCCTGGCTACATCAAACTTCGCAAGATTCGAGCAGCCCAGAATATCTCCAAGACGATCGCCACATCACAGAATCGTATCTATCTCACAGCTGACAACCTTGTGCTGAACCTACAGGATGAAAGTTTCACCAGGGGAAGTGACAGCCTCATCAAGGGTAAGAAATGAGCCTAGTCACCAAGAACTCCACCCCCAGAGGAAGTGGATCTGCTTCTCCAGTTTTTGAGGAGCCAGCCAGGGGTCCAGCACAGCCCTACCCCGCCCCAGTATCATGCGATGGTCCCCCACACCGGTTCCCTGAACCCCTCTTGGATTAAGGAAGACTGAAGACTAGCCCCTTTTCTGGGGAATTACTTTCCTCCTCCCTGTGTTAACTGGGGCTGTTGGGGACAGTGCGTGATTTCTCAGTGATTTCCTACAGTGTTGTTCCCTCCCTCAAGGCTGGGAGGAGATAAACACCAACCCAGGAATTCTCAATAAATTTTTATTACTTAACCTG