Transcript asmbl_24468

Sequence
Transcript Sequence for observation asmbl_24468 of TGE0056492:
CCACGGGCGGGGCGGGGCCGGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGAGTCCCGAGGATAAAGCTTGGGGTTCATCCTCCTTCCCTGGATCACTCCACAGTCCTCAGGCTTCCCCAATCCAGGGGACTCGGCGCCGGGACGCTGCTATGGACGACATTTTCACTCAGTGCCGGGAGGGCAACGCAGTCGCCGTTCGCCTGTGGCTGGACAACACGGAGAACGACCTCAACCAGGGGGACGATCATGGCTTCTCCCCCTTGCACTGGGCCTGCCGAGAGGGCCGCTCTGCTGTGGTTGAGATGTTGATCATGCGGGGGGCACGGATCAATGTAATGAACCGTGGGGATGACACCCCCCTGCATCTGGCAGCCAGTCATGGACACCGTGATATTGTACAGAAGCTATTGCAGTACAAGGCAGACATCAATGCAGTGAATGAACACGGGAATGTGCCCCTGCACTATGCCTGTTTTTGGGGCCAAGATCAAGTGGCAGAGGACCTGGTGGCAAATGGGGCCCTTGTCAGCATCTGTAACAAGTATGGAGAGATGCCTGTGGACAAAGCCAAGGCACCCCTGAGAGAGCTTCTCCGAGAGCGGGCAGAGAAGATGGGCCAGAATCTCAACCGTATTCCATACAAGGACACATTCTGGAAGGGGACCACCCGCACTCGGCCCCGAAATGGAACCCTGAACAAACACTCTGGCATTGACTTCAAACAGCTTAACTTCCTGACGAAGCTCAACGAGAATCACTCTGGAGAGCTATGGAAGGGCCGCTGGCAGGGCAATGACATTGTCGTGAAGGTGCTGAAGGTTCGAGACTGGAGTACAAGGAAGAGCAGGGACTTCAATGAAGAGTGTCCCCGGCTCAGGATTTTCTCGCATCCAAATGTGCTCCCAGTGCTAGGTGCCTGCCAGTCTCCACCTGCTCCTCATCCTACTCTCATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAGGCCTTCGGCCTACCATCCCACCAGGTATTTCCCCTCATGTGTGTAAGCTCATGAAGATCTGCATGAATGAAGACCCTGCAAAGCGACCCAAATTTGACATGATTGTGCCTATCCTTGAGAAGATGCAGGACAAGTAGGACTGGAAGGTCCTTGCCTGAACTCCAGAGGTGTCGGGACATGGTTGGGGGAATGCACCTCCCCAAAGCAGCAGGCCTCTGGTTGCCTCCCCCGCCTCCAGTCATGGTACTACCCCAGCCATGGGGTCCATCCCCTTCCCCCATCCCTACCACTGTGGCCCCAAGAGGGGCGGGCTCAGAGCTTTGTCACTTGCCACATGGTGTCTCCCAACATGGGAGGGATCAGCCCCGCCTGTCACAATAAAGTTTATTATGAAAAC