Transcript asmbl_19819

Sequence
Transcript Sequence for observation asmbl_19819 of TGE0056486:
GGGCTACATTGGCTGGCAGGGGCTGAGCAGCGGTGAGCCTGGCTGGCTTCGACCCGGGGCGACTCCGGGCATCCGGGACAGCTTCTCCTCGCTGCCACCTCGGCCAGTCAGACCCCGAGACACCTGTCACTACCCCCTCAGCCTTCCCAAGCCAGGAGCCTGGGAGTCCGGCTCTGGCCTACCTCCGGCAGCGCTCCTAGGCGCAGCTCCCGGGCTGGCGGCGCCGGGGCCCGCCCCCTAGGGCTGCGGCGCGCGGGGCGGGGGCTGGGGGCTGCGCGGGGCGGGGCGGGCCCGGGCGCTCCGGGCCCCCTCCCCCGCCCCCCTGACGTCAGCCCCCGGCAGCCTCGAGCTGCTCACTTGGCTCTCGCCCTCCGGCCGGGAAGCATGGGGCTTCCCAGGCTGGTCTGCGCCTTCTTGCTCGCCGCCTGCTGCTGCTGTCCTCGCGTCGCGGGTGTGCCCGGAGAGGCTGAGCAGCCTGCGCCTGAGCTGGTGGAGGTGGAAGTGGGCAGCACAGCCCTTCTGAAGTGCGGCCTCTCCCAGTCCCAAGGCAACCTCAGCCATGTCGACTGGTTTTCTGTCCACAAGGAGAAGCGGACGCTCATCTTCCGTGTGCGCCAGGGCCAGGGCCAGAGCGAACCTGGGGAGTACGAGCAGCGGCTCAGCCTCCAGGACAGAGGGGCTACTCTGGCCCTGACTCAAGTCACCCCCCAAGACGAGCGCATCTTCTTGTGCCAGGGCAAGCGCCCTCGGTCCCAGGAGTACCGCATCCAGCTCCGCGTCTACAAAGCTCCGGAGGAGCCAAACATCCAGGTCAACCCCCTGGGCATCCCTGTGAACAGTAAGGAGCCTGAGGAGGTCGCTACCTGTGTAGGGAGGAACGGGTACCCCATTCCTCAAGTCATCTGGTACAAGAATGGCCGGCCTCTGAAGGAGGAGAAGAACCGGGTCCACATTCAGTCGTCCCAGACTGTGGAGTCGAGTGGTTTGTACACCTTGCAGAGTATTCTGAAGGCACAGCTGGTTAAAGAAGACAAAGATGCCCAGTTTTACTGTGAGCTCAACTACCGGCTGCCCAGTGGGAACCACATGAAGGAGTCCAGGGAAGTCACCGTCCCTGTTTTCTACCCGACAGAAAAAGTGTGGCTGGAAGTGGAGCCCGTGGGAATGCTGAAGGAAGGGGACCGCGTGGAAATCAGGTGTTTGGCTGATGGCAACCCTCCACCACACTTCAGCATCAGCAAGCAGAACCCCAGCACCAGGGAGGCAGAGGAAGAGACAACCAACGACAACGGGGTCCTGGTGCTGGAGCCTGCCCGGAAGGAACACAGTGGGCGCTATGAATGTCAGGGCCTGGACTTGGACACCATGATATCGCTGCTGAGTGAACCACAGGAACTACTGGTGAACTATGTGTCTGACGTCCGAGTGAGTCCCGCAGCCCCTGAGAGACAGGAAGGCAGCAGCCTCACCCTGACCTGTGAGGCAGAGAGTAGCCAGGACCTCGAGTTCCAGTGGCTGAGAGAAGAGACAGGCCAGGTGCTGGAAAGGGGGCCTGTGCTTCAGTTGCATGACCTGAAACGGGAGGCAGGAGGCGGCTATCGCTGCGTGGCGTCTGTGCCCAGCATACCCGGCCTGAACCGCACACAGCTGGTCAACGTGGCCATTTTTGGCCCCCCTTGGATGGCATTCAAGGAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAACGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGGTGTTGAATGCACGGCCTCCAACGACCTGGGCAAAAACACCAGCATCCTCTTCCTGGAGCTGGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCACTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGTGTGCATCCTGGTCCTGGCGGTGCTGGGCGCTGTCCTCTATTTCCTCTATAAGAAGGGCAAGCTGCCGTGCAGGCGCTCAGGGAAGCAGGAGATGTAAGCCCAACACCGGCCCCTCCGCCCCCGCCCGTTTTGCCACCCAGCCTGCTGCCTGCCCAGCGCCCGCCTGCCCCTTGACAGCAGGAGTGGGGCCCTGGGTCAGGGTGCTGCCTGCTCCACTACCCACTGCCCAGCTTCCATCAGCCACATGGTCTCATGACCTGCTTCCCTGCCCTGGGCTGGCCCTGGAGCAAGGAGCCCTCATCCATTCCACATCCTTCACAGCGGGCCCTTCTCTTCCTGTGGCCCTGAGATACCAACCTCTCACCTCCCTCCCTCCTCCCAGCACGCTACCCCCGTCTCGTAAGAGCGAACTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTGCAGGGCAGCAGCGGTGACAAGAGGGCTCCGGGAGACCAGGTAGGAGGCGGTTCCTGTGGCCAGAGCCTGCCACATCCTCAGGGACCGGGGGCAGTAGGGACTAACGGTTCTCTCTATCCTTCATCCCTCTTTGTCAGAGATAGGGAGCAGGCCCCATCTTGCCTTCTTAACACTACTCACAGATGGCAGGGCCAAGCAAGTGGCTGAGGGAGCTTGGAGGAAGACTGAGAAAGACCCTGTCCCATCACCTTTTCCTGACCAATGCCCGTGGCTCTGGGTGTGGCCATTTCACCAGTGCAGTCAGACGGGGGCCGCCCTCCTTCCCTGGCCTGCCATGCCCATCCTAGCTTCCTCCCCAACGCTGCCCACCAAATTCATCGGCTTCTGCTTCCATCTCTCCTTCCTCTCGGTGCTCACACCTTCAACTCAGCACCGTCTCCGTGTTCCCCTCTTCTCCTCTACCCACTTTTAGGGAGAGAAATACATCGATCTGAGGCATTAGCCCCGAATCACTTCAGCTCCCTTCCCTGCCTGGACCATTCCCAGCTCCCTGCTCACTCTTCTCTCAGCCAAAGCCTCCAAAGGGACTAGAGAGAAGCCTCCTGCTCCCCTCGCCTGCACACCCCCTTTCAGAGGGCCACTGGGTTAGGACCTGAGGACCTCACTTGGCCCTGCAAGGCCCGCTTTTCAGGGACCAGTCCACCACCATCTCCTCCACGTTGAGTGAAGCTCATCCCAAGCAAGGAGCCCCAGTCTCCCGAGCGGGTAGGAGAGTTTCTTGCAGAACGTGTTTTTTCTTTACACACATTATGGCTGTAAATACCTGGCTCCTGCCAGCAGCTGAGCTGGGTAGCCTCTCTGAGCTGGTTTCCTGCCCCAAAGGCTGGCTTCCACCATCCAGGTGCACCACTGAAGTGAGGACACACCGGAGCCAGGCGCCTGCTCATGTTGAAGTGCGCTGTTCACACCCGCTCCGGAGAGCACCCCAGCAGCATCCAGAAGCAGCTGCAGTGTTGCTGCCACCACCCTCCTGTCTGCCTCTTCAAAGTCTCCTGTGACATTTTTTCTTTGGTCAGAAGCCAGGAACTGGTGTCATTCCTTAAAAGATACGTGCCGGGGCCAGGTGTGGTGGCTCACGCCT