Transcript asmbl_14359

Sequence
Transcript Sequence for observation asmbl_14359 of TGE0056481:
CGCGGTAGCGCGCGATGCAGCACAGGCTAGAGGCTGCGCAAGCGCGGGGCCCGCCCCTGGGACCCTCCGGGCCGGGCGGTTTGGCCCCTTAGCGCCCGGGCGTCGGGGCGGTAAAAGGCCGGCAGAAGGGAGGCACTTGAGGTAGGTGCTGCGCGCCGGGGCTCCGCGAGGCACGTGATGTCCGTAGGCGGGGCCTGCCGCGGCGTAGGTGGGGAAACTGAGGCAGTGCAGGGCCGGTAGGGTGGGTGCTGGGCTGGTGAGGCGCGCCCCTCGGGCCCGCGCCAACTTTCTTAGGAGCCGCCGCAGCGCTGGCGCTCCCTCCGAGGACGACGACCCTTCCGCCACCCTGCGTGGCGGCCGATGGAAAAACCCTGCGCCCAGACGTCGGAGAACGGAGACGGGGACCCGGCGCTGCTGCGGCGGGCTAGGGCCCCCTCTGTCCACGCCCGCAAGCCTTGAGTGACGCCGGTGGCGCCAACCTTCGCGAATTGTTGGGACAAAGAACAGAGGAGAGGGCCCTGCCCTGGAGCATGGGCCCGGGGGCCGCCCTGCTGGACCAGCCCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGGGACATTCACCTGTGTTCATGGGATGTATTGTTTCCACTCGTGTCCCTAAGGAGTGAGAAACCCATTTATACTCTACTCTCAGTATGGATTATTAATGTATTTTAATATTCTGTTTAGGCCCACTAAGGCAAAATAGCCCCAAAACAAGACTGACAAAAATCTGAAAAACTAATGAGGATTATTAAGCTAAAACCTGGGAAATAGGAGGCTTAAAATTGACTGCCAGGCTGGGTGCAGTGGCTCACACCTGTAATCCCAGC