Transcript asmbl_14332

Sequence
Transcript Sequence for observation asmbl_14332 of TGE0003332:
CTCTGAGGCTGCCCGGATAGCTGCCTGATCCAAGGCCCAGCAGCTTCTGCCTTCCGGATCCCCACCGACGGACGGAGGCAGCCCACCTGCAGGACCGGGGCGCTGTCGGTCCACGTGGCCGCTCTGGAGCAGGTTGGAGTTGGCAGCGGGCTGCGCTGCAGGGACAGGCGCGGCGGACAGCCCCGGGGGCAGCGGCGGGGTCCTGTCTGGGAGAGGACAGGGTTGCGGCGGGCGGAACGGTGTCTCCTTCACTTCGCCCTCCAGCTGCTGGAGCTGCAGCCCGACCGCGAGCGTGCCAAGCGGCTTCAGCAGCTAGCGGAGCGGTGGCGGCGGCCCCCCTCAGGACACCACCAGATTCCCCTCTTCCCGCGGCCTCGCCATGGCGACCCACGGACAGACTTGCGCGCGTCCAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAATCCAGCTGAAAGAAACCTTTGGGAATGGATATCAGAAGATTTGGCCTTAATATATTTCCATTGTGACCAGCAGCAGGCTTTTTTCCCCCAAGAAGATGATCAAAACAAAGGATGATCTCAACAAGAGCTGTATTTTAAGTATTTAGACAGTTCTTTGTTAGCTGGTTTCTAGTTGGTTATCTAGTTACCAATGCTGCAGTCCTGCAGTCACCTATACATTATTTAAATGTATTTAACTGTTAAATGCGCTACCCACCAATAATGAAATAGACCTTTATGAAAACTGTGCAATTGTGTGCATGTTTGTTTTTATGTTCCTTTAGAAAACATTGACTGTTACCATTGAATGAGATGGATCAGTGGATATTAAGATGAGGTTACAAATTTTGTTAAGTTCAGCCATTATTACTTTTGGTATCCCAGAACATGACAAATTATGAATAAAACAAGTATACATAA