Transcript asmbl_125034

Sequence
Transcript Sequence for observation asmbl_125034 of TGE0056453:
GGACATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGTAAGGAAGTGCTTACAAAATACTGCTGCAGTTCATCTTCCTACCTTAAGTGGGGCTACCACATGATCCCCTGTGAAAGCAAATCTAAGATCTTCTGAGAGACCAATGGCTTCTTAATGTTCATTTCCTGAATGAGGCATGTCTTTCTGTAGCCCCCACACACAAAAAAGTAGTCTTTGTAAGTTTTCAATATCTCTCATTATTCGTAAAACCAGAGAGAACTGAAGAAGGACAATACAAATTTGATTTGTCATTCCCAAGAATTGTTTGTTAAAAAAAACTCTGACCTTTCGTTGTACTAGGTATAAGAAGGGGAAATGTAATTTTTTTATTATGTGCAATGGAAAGAGTAAGCATATTTAACGTTATTTTTAACAGAGAACTTTGGAATGGTTTATAGATGTCAATTTATATTGTCAAAATATTACTGCAATGATATAACAAGAGTATAGGATAAATTATAATAATATATGCTTTCTAACATATTGTTTTATTTAGTTTCAGTGACATTGCTGATTATTTATATGCCAAACCACTGGCAACATAAGAAAAATCATATCATTTTAAAGCCTGGAATTTCCATTTAAAACAAACAAACAACTAATATTTGCATTATGCCTTCTCATGGAACAGTATTCTCTAGAGAATTCATTACAGTGCTTCACTAAGGATAGAGATTTCTTTGTGCACCCCCATCCACTTCTGCTATACCAGTACATTATCATGTACATAATAGGCACTCATGAACTTTTTGTTCAACAAATGCATACATATCAGATCAATTTGCTTGAAAAATGCAAAATAATTTTTACATACATTGAAGGTTTTATCATTTTAATAGAAATTGTTCAAGCATATTAAGGAACAAGAGTTAGCATTTGAATAATTGCCCATAATAAAAAATTCTTATTTGCTTTTGACATTTCTGAATTTGCTTTCCATTTTAAGACTATCAGGGTTCTTAATATATATTTATGGAGGTTACATGGATTAGTGTGACCCAAGAGAATGATGGTAGTCAACATTTCAAAGTTAATAAAGACCGCTTGTGACAATAGGGCAGGGATTATATTTTTCATATATAAAAGAAAAAAATCTGTCATTTAGTAAGGTTGATCTATTTGTCTAAGATTATGCAGCTTTGAAATTGCAGAGTCAGAATTTGAATACAGAAATTCTAACATCAAAATGCAAGGTCCAGGTTACGGTTGAATTATTGATTTATAAGTAACATTTGCTGATAATTACTTTGAACAACACAGAGTAAAAAATCTTTAGAGATCCCCTTGGAGTTGTCTTACTATAGAGCATAATCTTAAAGCAATTTAGTTCAGCAAACATTTATTCTGCAAACATATATTCAGACTCTAGTGTTTACAAGGCACCTTGAGAGAAACTGTGGAAGATATTTGACAAACAAAATAAGGTCCCTATCTTTAAAGAACTTGCAATCTTATTGTTGACTACTCTGATTGTATTGGGCACAAAGCGATTGCCTATATAATCTTTGACAAGGTCTAACATTATTGTGCAGATATCATTTCAGCAGATAGTGAAGTGTTTACTTTTGTGTTTCTTGACAGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGGTAACAATAAATTTCTTTTTCTGGAATCTGTTTATGGAAGATGCAATTTTCTTTTTTGATGACAAATAAGAGAAAGTAAAAACAGAACCCTTTTTCAATATCACTCCTGTATCAAACAGATACAGTGTTCCTGACCCATTGTTATTTGTCAATTTGTCCAATTTTGTACAGCCGCTACTTTATCATATTTAATACATTTTGTGACTTGGGCATGTGGAACATAATTTTGTTATTTTCACTGCTTTTACTCCCCTAAAAGATTTGGAATATGTGTGGGAAAAGACATGCATAACAGAACAAATGAAATTAGAATG