Transcript asmbl_119994

Sequence
Transcript Sequence for observation asmbl_119994 of TGE0056079:
GCACCCTCCTGAAAACTGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAAGCCAAGGGACGTTGACCTGGACTGAAGTTCGCATTGAACTCTACAACATTCTGTGGGATATATTGTTCAAAAAGATATTGTTGTTTTCCATGATTTAGCAAGCAACTAATTTTCTCCCAAGCTGATTTTATTCAATATGGTTACGTTGGTTAAATAAACTTTTTTTAGATTTAGAAGGTGATGTAATGATGTATTCATTGTGCTTATGATGTATTCTTAGTCATAACTGAGTGAAGGAAATGGGAAATTTGCATTATTTCTTTGTTCTGATATGAATAATAACATATTTCATAATAATTCAAGGTAAAAAGGGATATCTATGGATTTCCCTAGGTAGGAGATAACAAGTATGTACCATTACTGAATATTAAATCCTTCTTTACCATAGCTACAGTTAAGTAGGTGTATCTCAGAAACCTAAGGTAGTTTTAAATGTAGTGAAATTGTCCACAGCAAGCTGGCCCAAGTGCTCACATTTTATACCCGCTCTGTCTTAGTGCGTTGCAAGAGAGGAGTATATACAGTAGTTCCCCCTTATCCACAGGGGTACATTCTAAGACCCCCGGTGGGTGACTGAAACCACAGATAGTACCGAATCTTATACATACTATGTTTTTTTTCTAAACATAAATACCTACAATAAAGTTTAATTTTTAAATTAGGCACCATAATTAATAATAAAACAGAACAGTTATAACAATATACTATAATAAAATTATGTGTATGTGATCTCTCTTTCTCTCTCCCTCTCAAAATATTTTTAATATCTCTCCAGAATTCAGTGCAAATAATTCCATCATACTCACTTCAGAAAAGTGAAGATAGTCTTGTACATGAGTAGATTCAAATTTTATTGTCGTGGTTTCCAAAGTTTTATTTTTCTCACCAATGGAACTTTTGATTCAAATAAAATATCCAAGGGATTTCAGCTTATAAAACACACAAAATTGATAATGAGTTTTCCAAGGTACTGTGTGTGTGAATGTGTATGTCTGTGTATGTGTGTGTCGTCTGTATGTTTTTCCCACCTCTTGTAGAAGCTACGAAGCACCTTTCCATATTATTGAGGTTTCCTGTACGTAGACTGAAATTTACAAATCACATGCTTACATTTTATAGTAAGACAAAATCTGCCAAAGTGTATATTGCTGTTGATATAATTCTGTTTGTGATTCTCTCTTTAAAAATAAATCCAAAGGTTTTCATTTCCTGCATACTTATCCTATGCATAACACCATGATATGCAGAGGCCAGAAGAGATGGACTAGTTCACTGACCATAAGAATTTACTGTTTTTATAAAAACATAGAGTTAGACTCTCACTTTGGGTTTGAGGAACTTAAATATAGAAGATGTATAAGCATTGATAAGGACAATTCTTGGTAAACAAATGTTTATTAAGTACTAATGATGGTGCCAGGCACTTTGCAAGCTTTAAATCATTTGTCATCAAAATAATCTGATGGGAGGATTTGGATTTCTGTTTACAGATAAAGAAATTGAGGCACAGAGCTAAACATCATAAAACTGAGTAAGAAATAGATATAAGAATCTGAAATTCAAGAG