Transcript asmbl_17368

Sequence
Transcript Sequence for observation asmbl_17368 of TGE0001880:
CTCGTGACAGGTACTTCCGCTCGGGGCGGTGGCAGTGACGGAAGTGGGAGCGGAGCCGGATTCTTGGCCATAAAGCCCGAGGCGGCGGTGGTGGCGGCGGCTTTGGAAGCTTGGAGAGCGACGAAGAGTCCGCTGAAACCGGAACTTGGACTTCTCTGCCCCTGTCCTCGCCTTGTAGTTCCTCTTCAGCGGGAGCCTTCGTGACGTGCCCGGCCCGAAGCCCCGTTCGGAGCGGCCGAGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGTAAGACATCACTCATGAACCAGTATGTGAACAAGAAATTCAGTAATCAATACAAAGCCACAATAGGAGCAGACTTTCTGACAAAGGAGGTGATGGTGGATGACAGACTAGTTACAATGCAGATCTGGGACACGGCAGGACAGGAACGGTTCCAGTCTCTTGGTGTGGCCTTTTATAGAGGCGCAGACTGCTGTGTTCTGGTATTTGATGTGACTGCCCCGAACACATTCAAAACCCTTGATAGTTGGAGAGATGAGTTTCTCATCCAGGCCAGCCCTCGGGATCCTGAAAACTTTCCCTTTGTAGTGTTGGGAAATAAGATTGACCTCGAAAACAGACAAGTGGCCACGAAGCGAGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCCTTCCAGACGATTGCACGGAATGCACTTAAACAGGAAACAGAGGTGGAGCTGTACAATGAATTTCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAATGGGCAATGAGAGCAGAGCACAGAGTCCTTCACAAACCAAGAACACACTTAGGCCTTCCAACATAAATCCCTTCTCCTCTTCTAAACAAAGCATAAAGTGATTTCTCAGACGCAGTTGCCAAAAGAAACCCCACCAGACACACTCACCCCTCCATACAACACACATACAAATCTGATACAAGCAGACAGACTCCAGTCACAGGCCTGTGAGCTCTATCAGGGTCTGCCCACCTATCACATCAGCCCTCGTATAGCAGCATGACAGGCCAGCTGTAGAAATCGTTCTGGTGTTGGCATCGGAAGCTAATTCTTTTTGTCCACCAGAGAGGGAGAACTGTTTACAGTTAATCTATGTCGGATTGGTTATCTTAATTTTTTTTAATGGTCTTGTGGTCTTTTTACCCCATCCCCATTCCCCTCTTGTGAAGGCTACCACTTGGGAAGGCTGGTGCCCTATGCTTCATTACAGGCTCACACCCAGTCTGTTCAGGCTGAGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCATGTAAGATGGAGGGTTGAACACTGTCTGGATTGCAGAATGTTAGCAACTCAATTCAGAAATCCAGCTAGAGGCAGTATTCTGTACAGTAAACACAAGAATTATGTACACCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTATCTAAATTTTCCAAAAGGTTGATTTGCATAATACAGTGGTGAATGCAGTAGATAAATGGCTGTTGTTAAAATTCTTGTTTTTCCTTTTTTTCTTGCTCCACCCTTTGAAACTCCCCTATTAGATCAGCATCCTACTTATAAGAGGAAAAGGAAAATCCTAACAAATCTGTCCTAGTGATTTACCTTTGTTCTAGAAGGCGCTCTTTTCAGGGTTGTGGTATCCCTTAGGTTAGCAAACCTTTTTCTCCTTTTCCCCACCTCCCCAGTATTGCCCATTATTGATTAACCTGTTTCTTTGGTGTGGAATCCTGGCAGTTCTTCCCCCTTCCTAGGGTCTGCCCCTGCATTCTAGCTTGTTTAATGGAGCACTTCCCCCTTTCCCAAAGGTCTACATTCTAGGGTGTGGGCCAAGTTCTTTCTGTAAAGAGATGAACCTGATGCCAATAAAATGTAACAAGAGCAAAGATCATTGCCTTTGCCCTGTCTTTTTTTGTTCTTCCAGACCTTTGGCTCAGTAGACACCATGTTAGCTAATCATAACCAATGCTTTATCAAGCAAAATAGCCCTCCATAACTGCGCATGTTTGGTGCTTTGAGGCAGAAAGGCCTTCCCATGTCCAGTCCTGCAGTACTTGTCCTTACTTTGTTTCTATTTTTTATCTTAGTCACAGTATTGGAGAGGGGCGCACTCTGAATGGAGAACACATTATCTGTCCCCTTAGAGGAGCAGCCACAAACTACTGGTGACCTATGGACCCTGCACAGCCTCTGAGTGTAACTCAGCCTTAGTGTTGTGTTGCTTTTTAATTGGCGTAGTTCTGGATTTCACTGGAGAGGAAGATTTGGCAGCAGGGACCCTCTATTTTAGCATATATAACCCACCAGCTGAAACTTAATAGATGCCACCTAGAACTAATTTTATAAAATAGTGTTTCAGTCAGTAGGTGGATATAGGTTTTGCAGATGTCCCCTGATGGCTTAGCTCTTGGAGTCTACTTTACTACACTTTTTTACCTTTCCACTTCTAAGGATCATCAGTTGCTTTCTTTCCTTGTACTTACTCTTGAGTCATACTTAACACGTTAAAAATAGCATTCTTAGAAGCTTCTGACTACAACTCCACTGTGGCTAGTGGTGCATGGCCTAACTCTCTGGTCCCACTCCCTGAGCTAGACCTAATTGGTGTTGTATTTGGCTTCTAGAGAAGCAGAATCCTTTCCAGCTTGGGACACACTGACTGGGGCCATGGTTTATGAGCCTTGTGTGATGCTTATCCCTACAAACCAGGCTACTGTTTCTCTCTGATTATGTTCCTCTAGTCCTAACCATGATGGTGACATGAAAATGGACCTTTACCTCTGATCTCAACCATCGTCCTAAAACTGATGATCATCTGGACGTTAACTTGCTTTATCTTGAGAGAGAAGCTTGAATATAACCGTATAAGTTGCCCTGATCCCAATCATAGCTCATCCTAATTTTAAACTTGATCTTAAACTGACATTGACTCTGATCTTCACCCTCATCTTGTCACAATCATCCTAATTGGTCTCCTTTAAATGACTTAAATCTGACCCTAAACATAATCCTGACTTTGAAGTTAACATGGGACCCTACTTTGACAACATTACTCTCCAGCCTGGGACTAATCAGTCTAATAACCCATCAGCCCTTTGTCTGGCTGACCTTAATTTCATTGTGTATACCTAAATTGTACACATACACACCATGTTCATCTAAATTTGGTTTATCCACAGAAAGAAGTAATGGCTGAGACTGAATCTTCACTAATCCAGTACTTTTTTCCATATTCCTACTTAGATTCAGCATAAGCATGTGCTTTTGAGAGAGACAAGTTTGCTTCAAGCAGTAAAGATTCTGAAATTTGCAGTAATACTCCTTATGTTCATTTGAAATTTGCCCTCCCTCCCAGTAAGAATATGATTTGAGACAAATGTGTTTTGCTGTGTTTACTTTCATCTCAGTTTACTCTAACAATTAGAAGTTACTTTTGAGAAGAATGTCTGGGAATGGCTAATACAAATACATTTCGGTAGTACTCCGTAGTTTAATCCAGACTCACTCTGACAGTAAGAATGTGAAATACAATACTTACTTTCATCTCAGTTTACTCCAACAAGCTATGAGGAGTCCAGGACTGAATTTGTTGCAGGAAGAGTTCTCATTCAAACTCCTATTCATTGATTCTAATTCCTCCTGCCTCTCAGTAAGAATATGCCTTTGAGGCTAATGTGTTGCATTCCTCATGTTCATGAGTTAACACTAACCAGCTATAAGGTTTAACCCTTGAGAAAACTGTTTGAGACTGAGCTTGTTTGCACTAATAATGATGCTTTCTAATAGCACTAATTTAGATTTGTGCCAATTCACACAACTCACAGTAAGAATGCCATAGAGATGAATGTATGTGGCACTGCTTATCTCTCTTAATTTACACTAACATGCAATTAGGAGTTACATAAATTGAATGATCAAGACAGTTTGATTATACTAATATGGATTCTTTTCATTAACCACTAATTAGACTCATCTTAATTGGTGCTTACTCCCAATAAGAGCTTGCTGTTGAGGTGAATGTATATTGCTGCATTTACGTTTGTCTTTTTCACTAATCCTAACCCAGACCCTGATGTTTAGCCAGATCTAAAGACCCATGATTTTCCCCCCAGTCTGACCTTGAACATGGACCTTAGTGGTCAACCGCTTTACCTTTATCATGATTCCGAAGGTCTTCCTGGACCTCACGTTGACTTCGACACTTCCTAGCCTTGAAATGACCTTGAAACTCTTATTCTGACCATGTCTGACTTTGAAGTTGACCCTGAAACTTTCGTTGTAATTCTGACCATGTCTCATGCTAATTTTAAGTTGACCTTGTACTTTACCTCAGACTGGACCTTTACCATGAACCTGATCTTGACCCACCATGGCTTTGAAATGATCTTGGACTTGATCTTATGAAATTGAACTTGGTCCTGACCCTGATCCAGCTCCTCTCCCTATGACTATCATGTTCCTCTTGAATTGCCCTAATTTTTGAGGACCTGAACTTGACCCCAAATATCATACTAATGTTCATCACAACCTTGGGATAAACTTGGACTTCACCTTAAAATTGACGTTCAGTCTGTTGCTGACAACGAAGGTTAATGCTGAACTTACCCTTGGATTTCATTAAAGTTGACCCTTATCCTGACCCTGATCATTCTGCCAGTGTCTCACACTGAATCACTGATTTTAACCTTGAACTACTTGACTCCAATCCTGCCCTTCGTACACTGGTGATCCTGACCATTATCACCTTGAAGTAACCTTGGATTAACTTTGAAATTGACCTCTATCCACTAATGTTCTGACCATGTCACACCCTTTTTTAAACTTGATCTTGAATATGACTTCACATTGATCTTGAATTTCACACACTGACATTCACTATCTTAACTCCCTGAACTTGGAATGACCGTGAACTTGACCTTGAACTTGAAAGTGGCCCTGAATCAGGTCCTAATTCTAACCTTTGTTTTTACCCTAGCTGTCCTTACTATATTTGCCCTCATTTTTAACTTGTCCTTGAAACTGACCTGGACTGTGATACTGAACCAAACACTGATACTGATGCCTTCATGACCTTGAACCTCATTCTGAAACACCCTGATTATTGTCCTGGCCATGTCATGCCCTAAGTTTATACTTGATTTTGAATCTGTCATCTGTCGCCGACAATTATCCTGATTTTAAGCCGCCCTAAACTTAAAATACCTTTGACCCTGGCCCTAATCCTTAGCCTTGTTCAGACATTTGACGTGATTCTCATCCTGATGCCAAGCAACATCTTGACTGCACCTTTTCCTAAGTATTAACTTGACCTTGAACTTGACCTTAATTCTTGTGATCCTCTTATACTAACAATCTTCCTGACCTTAAAGGGAAATTAGAGTTTTTCCTTGAATCTGACTGATTCTGACCCTGAACATCATTATAACTATGTCCCACTTTCATTTTGAACCTGACCTTGACCCTGCTCTAGCCCCTCACTTTGCCACTGACATCCTGACCTTTCTTGGCCTGATCTTGAAATAGCCTTGCCTTCATACAGCTTCTGCCGCTGTACTGAAAATGACCCATTTTGACCTGGAACCTTACGTTGACCCTAATCTTAACCATCCTTTGTTCACAGGCCATCATTCATACTCTAACCCACCCCAACTATGAAATAATCTTATCCTTGAAATTGACCTTAATACTGACTCTGATACTTACCCCTCCCTCTTACCTTCATCATGACTGATGATCATTGACCAGACCTGCCACACTTTGAACATGATCGTGAAGCCACCTGTGATCCTGACCATGATGTGCCTGTCTAGAGACCTTTTCCTATGTCCCAAACTATTATCACCACCAGATCCCATTTTGTTCTTTTTCATTGGCTCTTCTCTTGAATATGTCCTGTATTAGTTGCTAGGACTGCTATTATGCAAATACCACAGACTGGATAGCTTAAACAACAGAATTTTATTTTCTCACAGTTTTGGAGGATAGAAATCCAAGATCAAAGTGTCGGCAGAATTGTTTTTTTCTGAGGGCCTCTCTCCTTGACTTGTAGATGGGCATATTCTCTCTGTTTTCACATGGTCCTCCCTCTCTGTCTGTGTCCTAATCCCCTGTTCTTTTTAAAATTTTTCAATTACAGTTGACTATGATATTAGTTTCAGTTATCTTCTGCGAACACCAGTCATATTGAGCTAGGGCCCACCCATATGATCTCATTTAACTTAATTACGCCTTTAGAGAGCCTATCTCCAAATATAGTCACATTGCGAGGTACTGGGGGTTAGGGCTTCAACATAGAAATTTAGGAAGGGGACACAATTCAGGCCTTAACATGTCCTATCTACATACTGGCTCCCATGTCTGTCATTAACTTTATTTTGTAAAGCTGGCTTCATGCTAGGTTTCCCCTTTCCTGGCTTGTTTTAATCCTTAAAAATCTTTTAGGGTACAAATTATCCTCAGTAAAGTTGAGGAACCATGTTAATTACTTGCTGAAAGTTGGCTGGAAGAAGATTCCTTTCTCTCAAGCCTGGCTGTATATTGTTGCCAGCTGATGGCCTGGACCCTATCCAGTTTACTGAACTTTACAGCATTAGTGTGGGGCCCAGGTATCCTTTCA