Transcript asmbl_105238

Sequence
Transcript Sequence for observation asmbl_105238 of TGE0002407:
AGAAGAGCATGCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACGCCCCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCTTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGTCGTGAAAACTACCCCTAAAAGCCAAAATGGGAAAGGAAAAGACTCATATCAACATTGTCGTCATTGGACACGTAGATTCGGGCAAGTCCACCACTACTGGCCATCTGATCTATAAATGCGGTGGCATCGACAAAAGAACCATTGAAAAATTTGAGAAGGAGGCTGCTGAGATGGGAAAGGGCTCCTTCAAGTATGCCTGGGTCTTGGATAAACTGAAAGCTGAGCGTGAACGTGGTATCACCATTGATATCTCCTTGTGGAAATTTGAGACCAGCAAGTACTATGTGACTATCATTGATGCCCCAGGACACAGAGACTTTATCAAAAACATGATTACAGGGACATCTCAGGCTGACTGTGCTGTCCTGATTGTTGCTGCTGGTGTTGGTGAATTTGAAGCTGGTATCTCCAAGAATGGGCAGACCCGAGAGCATGCCCTTCTGGCTTACACACTGGGTGTGAAACAACTAATTGTCGGTGTTAACAAAATGGATTCCACTGAGCCACCCTACAGCCAGAAGAGATATGAGGAAATTGTTAAGGAAGTCAGCACTTACATTAAGAAAATTGGCTACAACCCCGACACAGTAGCATTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAACATGCCTTGGTTCAAGGGATGGAAAGTCACCCGTAAGGATGGCAATGCCAGTGGAACCACGCTGCTTGAGGCTCTGGACTGCATCCTACCACCAACTCGTCCAACTGACAAGCCCTTGCGCCTGCCTCTCCAGGATGTCTACAAAATTGGTGGTATTGGTACTGTTCCTGTTGGCCGAGTGGAGACTGGTGTTCTCAAACCCGGTATGGTGGTCACCTTTGCTCCAGTCAACGTTACAACGGAAGTAAAATCTGTCGAAATGCACCATGAAGCTTTGAGTGAAGCTCTTCCTGGGGACAATGTGGGCTTCAATGTCAAGAATGTGTCTGTCAAGGATGTTCGTCGTGGCAACGTTGCTGGTGACAGCAAAAATGACCCACCAATGGAAGCAGCTGGCTTCACTGCTCAGGTGATTATCCTGAACCATCCAGGCCAAATAAGCGCCGGCTATGCCCCTGTATTGGATTGCCACACGGCTCACATTGCATGCAAGTTTGCTGAGCTGAAGGAAAAGATTGATCGCCGTTCTGGTAAAAAGCTGGAAGATGGCCCTAAATTCTTGAAGTCTGGTGATGCTGCCATTGTTGATATGGTTCCTGGCAAGCCCATGTGTGTTGAGAGCTTCTCAGACTATCCACCTTTGGGTCGCTTTGCTGTTCGTGATATGAGACAGACAGTTGCGGTGGGTGTCATCAAAGCAGTGGACAAGAAGGCTGCTGGAGCTGGCAAGGTCACCAAGTCTGCCCAGAAAGCTCAGAAGGCTAAATGAATATTATCCCTAATACCTGCCACCCCACTCTTAATCAGTGGTGGAAGAACGGTCTCAGAACTGTTTGTTTCAATTGGCCATTTAAGTTTAGTAGTAAAAGACTGGTTAATGATAACAATGCATCGTAAAACCTTCAGAAGGAAAGGAGAATGTTTTGTGGACCACTTTGGTTTTCTTTTTTGCGTGTGGCAGTTTTAAGTTATTAGTTTTTAAAATCAGTACTTTTTAATGGAAACAACTTGACCAAAAATTTGTCACAGAATTTTGAGACCCATTAAAAAAGTTAAATGAGAAACCTGTGTGTTCCTTTGGTCAACACCGAGACATTTAGGTGAAAGACATCTAATTCTGGTTTTACGAATCTGGAAACTTCTTGAAAATGTAATTCTTGAGTTAACACTTCTGGGTGGAGAATAGGGTTGTTTTCCCCCCACATAATTGGAAGGGGAAGGAATATCATTTAAAGCTATGGGAGGGTTGCTTTGATTACAACACTGGAGAGAAATGCAGCATGTTGCTGATTGCCTGTCACTAAAACAGGCCAAAAACTGAGTCCTTGTGTTGCATAGAAAGCTTCATGTTGCTAAACCAATGTTAAGTGAATCTTTGGAAACAAAATGTTTCCAAATTACTGGGATGTGCATGTTGAAACGTGGGTTAAAATGACTGGGCAGTGAAAGTTGACTATTTGCCATGACATAAGAAATAAGTGTAGTGGCTAGTGTACACCCTATGAGTGGAAGGGTCCATTTTGAAGTCAGTGGAGTAAGCTTTATGCCAGTTTGATGGTTTCACAAGTTCTATTGAGTGCTATTCAGAATAGGAACAAGGTTCTAATAGAAAAAGATGGCAATTTGAAGTAGCTATAAAATTAGACTAATCTACATTGCTTTTCTCCTGCAGAGTCTAATACCTTTTATGCTTTGATAATTAGCAGTTTGTCTACTTGGTCACTAGGAATGAAACTACATGGTAATAGGCTTAACAGGTGTAATAGCCCACTTACTCCTGAATCTTTAAGCATTTGTGCATTTGAAAAATGCTTTTCGCGATCTTCCTGCTGGGATTACAGGCATGAGCC