Transcript asmbl_9577

Sequence
Transcript Sequence for observation asmbl_9577 of TGE0040583:
CCCACTTCCGCGGGCACCCAACTGTGCGTCTCCTGCGCGCTGACGTCAGGTGCGTGCCCCTGTCCGGCAGCCGAGGAGACCCCGCGCAGTGCTGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCAGATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACAGAGAGGTCTGAAGAATGTGTTTGATGAGGCTATCCTAGCTGCCCTCGAGCCTCCGGAAACTCAACCCAAAAGGAAGTGCTGTATATTCTAAACTGTTTTCTCCTTCCCTTCTTTGCTGCTGCTTCCTGTCCCACTACTGTAGAAAGATCGTTTAAAAACAAAGGAATAAAACCATCCTGTTTGAAAGCCTCTGCGTCTTTTTACTCACCACCTTAGAGCAACCTCTGTATTAGTTTTTGATCAAGAATGCAATATCATATAAATTTTTTGTGATCAGTAGTCAAGTTGGACTTGTTTTAACGTTCTGCTGCTTGAGTTGCCTGATGCTCAGAGCTTTTTGGTTTGGATTACTATTGCAAAAGGGAAC