Transcript asmbl_91777

Sequence
Transcript Sequence for observation asmbl_91777 of TGE0056395:
CGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGAGCTCAATGACCGGCTGGCGGTGTACATCGACAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACGGAGCGCGAGGAGGTGCGCGGCCGTGAGCTCACCGGCCTCAAGGCGCTCTACGAGACCGAGCTGGCCGACGCGCGACGCGCGCTCGACGACACGGCCCGCGAGCGCGCCAAGCTGCAGATCGAGCTGGGCAAGTGCAAGGCGGAACACGACCAGCTGCTCCTCAACTATGCTAAGAAGGAATCTGATCTTAATGGCGCCCAGATCAAGCTTCGAGAATATGAAGCAGCACTGAATTCGAAAGATGCAGCTCTTGCTACTGCACTTGGTGACAAAAAAAGTTTAGAGGGAGATTTGGAGGATCTGAAGGATCAGATTGCCCAGTTGGAAGCCTCCTTAGCTGCAGCCAAAAAACAGTTAGCAGATGAAACTTTACTTAAAGTAGATTTGGAGAATCGTTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGCAAAAGCATGTATGAAGAGGAGATTAACGAGACCAGAAGGAAGCATGAAACGCGCTTGGTAGAGGTGGATTCTGGGCGTCAAATTGAGTATGAGTACAAGCTGGCGCAAGCCCTTCATGAGATGAGAGAGCAACATGATGCCCAAGTGAGGCTGTATAAGGAGGAGCTGGAGCAGACTTACCATGCCAAACTTGAGAATGCCAGACTGTCATCAGAGATGAATACTTCTACTGTCAACAGTGCCAGGGAAGAACTGATGGAAAGCCGCATGAGAATTGAGAGCCTTTCATCCCAGCTTTCTAATCTACAGAAAGAGTCTAGAGCATGTTTGGAAAGGATTCAAGAATTAGAGGACTTGCTTGCTAAAGAAAAAGACAACTCTCGTCGCATGCTGACAGACAAAGAGAGAGAGATGGCGGAAATAAGGGATCAAATGCAGCAACAGCTGAATGACTATGAACAGCTTCTTGATGTAAAGTTAGCCCTGGACATGGAAATCAGTGCTTACAGGAAACTCTTAGAAGGCGAAGAAGAGAGGTTGAAGCTGTCTCCAAGCCCTTCTTCCCGTGTGACAGTATCCCGAGCATCCTCAAGTCGTAGTGTACGTACAACTAGAGGAAAGCGGAAGAGGGTTGATGTGGAAGAATCAGAGGCGAGTAGTAGTGTTAGCATCTCTCATTCCGCCTCAGCCACTGGAAATGTTTGCATCGAAGAAATTGATGTTGATGGGAAATTTATCCGCTTGAAGAACACTTCTGAACAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTATAAATATACCTCAAGATATGTGCTGAAGGCAGGCCAGACTGTTACAATTTGGGCTGCAAACGCTGGTGTCACAGCCAGCCCCCCAACTGACCTCATCTGGAAGAACCAGAACTCGTGGGGCACTGGCGAAGATGTGAAGGTTATATTGAAAAATTCTCAGGGAGAGGAGGTTGCTCAAAGAAGTACAGTCTTTAAAACAACCATACCTGAAGAAGAGGAGGAGGAGGAAGAA