Transcript asmbl_8387

Sequence
Transcript Sequence for observation asmbl_8387 of TGE0056385:
GGTGAGAGGAGGCTGCAACGCCGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAAGAGGAGCACCTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAGAACGCCCCAGTCCCACCCTGCTGCTGCTCCTCCCTCTGACCCAGACTCCGCCTGAGGCCAGCCTGCGGGAAGCTGACCTTTAACTGAGGGCTGATCTTTAACTGGAAGGCTGCTTTCTCCTTTCACCACCCCCTCCTTCCCTGTGTCTTTTTCGCCAAACTGTCTCTGCCTCTTCCCGGAGAATCCAGCTGGGCTAGAGGCTGAGCACCTTTGGAAACAACATTTAAGGGAATGTGAGCACAATGCATAATGTCTTTAAAAAGCATGTTGTGATGTACACATTTTGTAATTACCTTTTTTGTTGTTTTGTAGCAACCATTTGTAAAACATTCCAAATAATTCCACAGTCCTGAAGCAGCAATCGAATCCCTTTCTCACTTTTGGAAGGTGACTTTTCACCTTAATGCATATTCCCCTCTCCATAGAGGAGAGGAAAAGGTGTAGGCCTGCCTTACCGAGAGCCAAACAGAGCCCAGGGAGACTCCGCTGTGGGAAACCTCATTGTTCTGTACAAAGTACTAGCTAAACCAGAAAGGTGATTCCAGGAGGAGTTAGCCAAACAACAACAAAAACAAAAAATGTGCTGTTCAAGTTTTCAGCTTTAAGATATCTTTGGATAATGTTATTTCTATTTTTTATTTTTTTCATTAGAAGTTACCAAATTAAGATGGTAAGACCTCTGAGACCAAAATTTTGTCCCATCTCTACCCCCTCACAACTGCTTACAGAATGGATCATGTCCCCCTTATGTTGAGGTGACCACTTAATTGCTTTCCTGCCTCCTTGAAAGAAAGAAAGAAAGAAGACTGTGTTTTTGCCACTGATTTAGCCATGTGAAACTCATCTCATTACCCTTTTCTGGGTTTGAAGCTGCTGTCTCTAGAAGTGCCATCTCAATTGTGCTTTGTATCAGTCAGTGCTGGAGAAATCTTGAATAGCTTATGTACAAAACTTTTTAAATTTTATATTATTTTGAAACTTTGCTTTGGGTTTGTGGCACCCTGGCCACCCCATCTGGCTGTGACAGCCTCTGCAGTCCGTGGGCTGGCAGTTTGTTGATCTTTTAAGTTTCCTTCCCTACCCAGTCCCCATTTTCTGGTAAGGTTTCTAGGAGGTCTGTTAGGTGTACATCCTGCAGCTTATTGGCTTAAAATGTACTCTCCTTTTATGTGGTCTCTTTGGGGCCGATTGGGAGAAAGAGAAATCAATAGTGCAACTGTTTTGATACTGAATATTGACAAGTGTCTTTTTGAAATAAAGAACCAGTCCCTCCAACCCTCAGACCTATTTGACTTTTATT