Transcript asmbl_82441

Sequence
Transcript Sequence for observation asmbl_82441 of TGE0056378:
GCCCTGGCGGGGGTGGGACGGGCCAAGCCGGGCAGGGCCGGGGTGGGGCCGCTGGCGTTTCCGTTGCTTGGATCAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCGGCTCTCCGCCGCTCTCCCGGGGTTTCGGGGCACTTGGGTCCCACAGTCTGGTCCTGCTTCACCTTCCCCTGACCTGAGTAGTCGCCATGGCACAGGTTCTCAGAGGCACTGTGACTGACTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAGAGCATCCTGACTCTGTTGACATCCCGAAGTAATGCTCAGCGCCAGGAAATCTCTGCAGCTTTTAAGACTCTGTTTGGCAGGGATCTTCTGGATGACCTGAAATCAGAACTAACTGGAAAATTTGAAAAATTAATTGTGGCTCTGATGAAACCCTCTCGGCTTTATGATGCTTATGAACTGAAACATGCCTTGAAGGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGTATTGCGTGGAGATTAATTACAGTTTGATTAAAAAGCCTGAAGTTGGACTGGGCTGAATCTAGTTAAGTAAGGTCACTTAAAATTCTTTTAATAATTTGTGGTACTTGCTGATTCTTACTGCGATGATTCTGACTGTATGTTGCCTGTGCTTGTTTGTGTTTCAGAATATCTGGTCTAAATTCTTAACAGCTAACTCATACATGTTTTAGATAGTAGTATCTTGTTCCTTTCATAGAATGATAGCGGTATCTTGTTCTTTCATAGAATTTAAAATCAGTAGGGTCATTATTGGTTTTGGACAGTGCTGGGTGATGATAACGTGAAATAGTGCAGGATTGATCTTAATAAAAGCATATTATTCCTAGAGAAAGAGTGTTATTGAATAACCATCAGGTGGAACCATTTTTCCTTTTGAATGAGAATGCTCTATAGTTCAGTAATGTGACATATTACCTCTCATAGGCTAACAGAGACCCTGATGCTGGAATTGATGAAGCTCAAGTTGAACAAGATGCTCAGGCTTTATTTCAGGCTGGAGAACTTAAATGGGGGACAGATGAAGAAAAGTTTATCACCATCTTTGGAACACGAAGTGTGTCTCATTTGAGAAAGGTGTTTGACAAGTACATGACTATATCAGGATTTCAAATTGAGGAAACCATTGACCGCGAGACTTCTGGCAATTTAGAGCAACTACTCCTTGCTGTTGTGAAATCTATTCGAAGTATACCTGCCTACCTTGCAGAGACCCTCTATTATGCTATGAAGGGAGCTGGGACAGATGATCATACCCTCATCAGAGTCATGGTTTCCAGGAGTGAGATTGATCTGTTTAACATCAGGAAGGAGTTTAGGAAGAATTTTGCCACCTCTCTTTATTCCATGATTAAGGGAGATACATCTGGGGACTATAAGAAAGCTCTTCTGCTGCTCTGTGGAGAAGATGACTAACGTGTCACGGGGAAGAGCTCCCTGCTGTGTGCCTGCACCACCCCACTGCCTTCCTTCAGCACCTTTAGCTGCATTTGTATGCCAGTGCTTAACACATTGCCTTATTCATACTAGCATGCTCATGACCAACACATACACGTCATAGAAGAAAATAGTGGTGCTTCTTTCTGATCTCTAGTGGAGATCTCTTTGACTGCTGTAGTACTAAAGTGTACTTAATGTTACTAAGTTTAATGCCTGGCCATTTTCCATTTATATATATTTTTTAAGAGGCTAGAGTGCTTTTAGCCTTTTTTAAAAACTCCATTTATATTACATTTGTAACCATGATACTTTAATCAGAAGCTTAGCCTTGAAATTGTGAACTCTTGGAAATGTTATTAGTGAAGTTCGCAACTAAACTAAACCTGTAAAATTATGATGATTGTATTCAAAAGATTAATGAAAAATAAACATTTCTGTCCCCCTGAATTATGTGTACATGT