Transcript asmbl_75077

Sequence
Transcript Sequence for observation asmbl_75077 of TGE0056356:
GTTGTTTTGGCGCCTACTGAGGTCTGAAGTTTGAATCCTGCAGTCAATTGGGATGGTGGCTTGTACCCCAAAGTGCCATTGCAACCCTTGTCCTTCCTGAGGAAAGGGTGGCAGTTGCCCTGTGGAATTCCTGCCCTGCTCCCCGTGGGTGTCCAGGCTGACAGAAGTTGGGACTGTGTCTGGCTGGCCGTAGGAGGAGTGTTCAGTGGTGCGCCGTATCCCAACCCGAGGCCACAAAATGCTTCCAATGGCAAAGGAATATGAGAAAAGTGCGTGGCCCTCCTGTCAGCTGCATAAAGAGAGACTCCCCCATCCAGTGTATCCAGGCCATTGCGGAAAACAGGGCCGATGCTGTGACCCTTGATGGTGGTTTCATATACGAGGCAGGCCTGGCCCCCTACAAACTGCGACCTGTAGCGGCGGAAGTCTACGGGACCGAAAGACAGCCACGAACTCACTATTATGCCGTGGCTGTGGTGAAGAAGGGCGGCAGCTTTCAGCTGAACGAACTGCAAGGTCTGAAGTCCTGCCACACAGGCCTTCGCAGGACCGCTGGATGGAATGTCCCTATAGGGACACTTCGTCCATTCTTGAATTGGACGGGTCCACCTGAGCCCATTGAGGCAGCTGTGGCCAGGTTCTTCTCAGCCAGCTGTGTTCCCGGTGCAGATAAAGGACAGTTCCCCAACCTGTGTCGCCTGTGTGCGGGGACAGGGGAAAACAAATGTGCCTTCTCCTCCCAGGAACCGTACTTCAGCTACTCTGGTGCCTTCAAGTGTCTGAGAGACGGGGCTGGAGACGTGGCTTTTATCAGAGAGAGCACAGTGTTTGAGGACCTGTCAGACGAGGCTGAAAGGGACGAGTATGAGTTACTCTGCCCAGACAACACTCGGAAGCCAGTGGACAAGTTCAAAGACTGCCATCTGGCCCGGGTCCCTTCTCATGCCGTTGTGGCACGAAGTGTGAATGGCAAGGAGGATGCCATCTGGAATCTTCTCCGCCAGGCACAGGAAAAGTTTGGAAAGGACAAGTCACCGAAATTCCAGCTCTTTGGCTCCCCTAGTGGGCAGAAAGATCTGCTGTTCAAGGACTCTGCCATTGGGTTTTCGAGGGTGCCCCCGAGGATAGATTCTGGGCTGTACCTTGGCTCCGGCTACTTCACTGCCATCCAGAACTTGAGGAAAAGTGAGGAGGAAGTGGCTGCCCGGCGTGCGCGGGTCGTGTGGTGTGCGGTGGGCGAGCAGGAGCTGCGCAAGTGTAACCAGTGGAGTGGCTTGAGCGAAGGCAGCGTGACCTGCTCCTCGGCCTCCACCACAGAGGACTGCATCGCCCTGGTGCTGAAAGGAGAAGCTGATGCCATGAGTTTGGATGGAGGATATGTGTACACTGCAGGCAAATGTGGTTTGGTGCCTGTCCTGGCAGAGAACTACAAATCCCAACAAAGCAGTGACCCTGATCCTAACTGTGTGGATAGACCTGTGGAAGGATATCTTGCTGTGGCGGTGGTTAGGAGATCAGACACTAGCCTTACCTGGAACTCTGTGAAAGGCAA