Transcript asmbl_61348

Sequence
Transcript Sequence for observation asmbl_61348 of TGE0001383:
CTAAGGCTTCCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCCTATCTCATTCCTTTCTTTCGATTACCCGTGGCGCGGAGAGTCAGGGCGGCGGCTGCGGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGTCTTGCCTTCTTCTTAGGTTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGACGGGAAAACAATCAAGCTTCAAATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAATGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAATTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCGAAGGAATTTGCTGATTCCCTTGGAATTCCGTTTTTGGAAACCAGTGCTAAGAATGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCCGGAGCAACAGCTGGTGGTGCTGAGAAGTCCAATGTTAAAATTCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCATCCTTTTCTCACAGCAATGAATTTGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAAGCAGTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTGATTCTTATGGTTAAAGGGAAATAGAGCCTTGCATTATATTCAACACAGCCATTTGTGTGTGCACAATGCAAACTAAGGTATTCTAGACCTATCTTAGAGCAGCATCCAGTATTTGCTTTCTAGATAATATGCCCAATAACATGACCTAGAGGGGCTTCTGTGCTGTGTAGGGATTTAACCAACTTCAGTGGTTCAGGGAGCTCAAACTATATGTAAAACAAGTTTAGAATGTATGCTATCTAGCCCGTTATCTCTGATCCTTCTCTAAAACCATTTGAAATAGCTTCATTGATCAACATTTCATAAATGCATCTGTGGTAGAGGTAGAAAGCAGCACCTTTCCTAATTGGCAAATGATCAGACTAATGTGTGCTAATGTTTTTCTTCCATGCTTTCAGTCAGATTCAACTATTTTATCCTCCACAGTTGCTTAACTTGGTGTTGGAGGAGGGTTTAAGCATTAAGATAGGAAGCAGGAAATTTGATTGCTCTAAATTTAGAAATTATATCCCTAAAAATTAAAACATGAATACTGGGTGGTAATGATAATTGAGGCAAATGTATTTATTTTGGTGACATTTTGCATATATGAAGATTTTCTGAAATAGGACCTTCAAGATCCTAGGGGGTTTTGTTTGGTTTTTAATTGTGAGGAATAAAAAATCTTCTGCCCACACTGGCATTTTAAGGTGACTGAGGTCAAACGTTGTTTCCTTAGGTTGAAATAGCAGCCAAAACATTCTTCACGCAGGGGCTTGGGATATGGCTGCTGGCAACACATTTTGTTGTGGGCTCCTTAATTTAATGATAAAATTTAAGCTAAACACAAGCCAAAAATGAATAGGTTTTTTTAATTTTTATTTTTCACTAAACAGGCAATTGAAATACATGGTACAAAAATAAGTGGTAAGATAATTGTAAAATGAAATGGACAGAATATTCAATTTTCCATCTATGAAAATTTCACAATAAAAATCATAGTTTACTTTGT