Transcript asmbl_60617

Sequence
Transcript Sequence for observation asmbl_60617 of TGE0056297:
GTGCGCTTCCTGGAGCAGCAGAACGCGGCGCTCGCCGCCGAAGTGAACCGGCTCAAGGGCCGCGAGCCGACGCGAGTGGCCGAGCTCTACGAGGAGGAGCTGCGGGAGCTGCGGCGCCAGGTGGAGGTGCTCACTAACCAGCGCGCGCGCGTCGACGTCGAGCGCGACAACCTGCTCGACGACCTGCAGCGGCTCAAGGCCAAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGCAGATGCGGGAATTGGAGGACCGATTTGCCAGTGAGGCCAGTGGCTACCAGGACAACATTGCGCGCCTGGAGGAGGAAATCCGGCACCTCAAGGATGAGATGGCCCGCCATCTGCGCGAGTACCAGGACCTGCTCAACGTGAAGATGGCCCTGGATGTGGAGATTGCCACCTACCGGAAGCTGCTGGAGGGAGAGGAGAGCCGGATCAATCTCCCCATCCAGACCTACTCTGCCCTCAACTTCCGAGAAACCAGCCCTGAGCAAAGGGGTTCTGAGGTCCATACCAAGAAGACGGTGATGATCAAGACCATCGAGACACGGGATGGGGAGGTCGTCAGTGAGGCCACACAGCAGCAGCATGAAGTGCTCTAAAGACAGAGACCCTCTGCCACCAGAGACCGTCCTCACCCCTGTCCTCACTGCTCCCTGAAGCCAGCCTTCTTCCATCCCAGGACACCACACCCAGCCTCAGTCCTCCCCTCACAGCCTCTGACCCCTCCTCACTGGCCATCCCTCGTGGTCCCCAACAGCGACATAGCCCATCCCTGCCTGGTCACAGGGCATGCCCCGGCCACCTCTGCGGACCCCAGCTGTGAGCCTTGGCTGTTGGCAGTGAGTGAGCCTGGCTCTTGTGCTGGATGGAGCCCAGGCGGGAGCGGTGGCCCTGTCCCTCCCACCTCTGTGACCTCAGGCACTAGCCTTTGGCTCTGGAGACAGCCCCAGAGCAGGGTGTTGGGATACTGCAGGGCCAGGACTGAGCCCCGCAGACCTCCCCAGCCCCTAGCCCAGGAGAGAGAAAGCCAGGCAGGTAGCCAGGGGGACTAGCCCCTGTGGAGACTGGGGGGCTTGAAATTGTCCCCGTGGTCTCTTACTTTCCTTTCCCCAGCCCAGGGTGGACTTAGAAAGCAGGGGCTACAAGAGGGAATCCCCGAAGGTGCTGGAGGTGGGAGCAGGAGATTGAGAAGGAGAGAAAGTGGGTGAGATGCTGGAGAAGAGAGGAGAGGAGAGAGGCAGAGAGCGGTCTCAGGCTGGTGGGAGGGGCGCCCACCTCCCCACGCCCTCCCCTCCCCTGCTGCAGGGGCTCTGGAGAGAAACAATAAAGAGATTCACACACAAGCCAAGCTGGCCCCTGTTGTCTTGACTGCCAGGTCTCCTGTGGGGCCCCTGGGGCCCTGTGATACAACCTGTCACCCTGAGATGGACTATACTGACCTTCTACCCAGCCAGACTTTCCCCAGGGCCTCGCGCCCACTTCTGTTCCCAGAGCCACCTGGCCTTGATGTCTGTATGCAGTGTATGGGGCAGGGAG