Transcript asmbl_25554

Sequence
Transcript Sequence for observation asmbl_25554 of TGE0000859:
GGGGTGGGACCAGGCGGGCCAAGAGGGCCGGGACGCCGCGCGGGGCAGTGTGGGACTGGGGCGGAACGCCGCCCGGCCGCGGGTCGGGCTCTGTGTCAGCAGCCGGGCGGGCGCTCGGGCGGGACATGGCAGCCTGTACAGCCCGGCGGGCCCTGGCCGTGGGCAGCCGCTGGTGGTCCCGGTCGCTGACTGGGGCCCGGTGGCCAAGGCCGCTCTGTGCGGCGGCCGGAGCTGGAGCCTTCTCGCCAGCGTCGACCACGACGACGCGGAGGCACCTCTCGTCCCGAAACCGACCAGAGGGCAAAGTGTTGGAGACAGTTGGTGTGTTTGAGGTGCCAAAACAGAATGGAAAATATGAGACCGGGCAGCTTTTCCTTCATAGCATTTTTGGCTACCGAGGTGTCGTCCTGTTTCCCTGGCAGGCCAGACTGTATGACCGGGATGTGGCTTCTGCAGCTCCAGAAAAAGCAGAGAACCCTGCTGGCCATGGCTCCAAGGAGGTGAAAGGCAAAACTCACACTTACTATCAGGTGCTGATTGATGCTCGTGACTGCCCACATATATCTCAGAGATCTCAGACAGAAGCTGTGACCTTCTTGGCTAACCATGATGACAGTCGGGCCCTCTATGCCATCCCAGGCTTGGACTATGTCAGCCATGAAGACATCCTCCCCTACACCTCCACTGATCAGGTTCCCATCCAACATGAACTCTTTGAAAGATTTCTTCTGTATGACCAGACAAAAGCACCTCCTTTTGTGGCTCGGGAGACGCTAAGGGCCTGGCAAGAGAAGAATCACCCCTGGCTGGAGCTCTCCGATGTTCATCGGGAAACAACTGAGAACATACGTGTCACTGTCATCCCCTTCTACATGGGCATGAGGGAAGCCCAGAATTCCCACGTGTACTGGTGGCGCTACTGTATCCGTTTGGAGAACCTTGACAGTGATGTGGTACAGCTCCGGGAGCGGCACTGGAGGATATTCAGTCTCTCTGGCACCTTGGAGACAGTGCGAGGCCGAGGGGTAGTGGGCAGGGAACCAGTGTTATCCAAGGAGCAGCCTGCGTTCCAGTATAGCAGCCACGTCTCGCTGCAGGCTTCCAGTGGGCACATGTGGGGCACGTTCCGCTTTGAAAGACCTGATGGCTCCCACTTTGATGTTCGGATTCCTCCCTTCTCCCTGGAAAGCAATAAAGATGAGAAGACACCACCCTCAGGCCTTCACTGGTAGGCCAGCTGAGGCCCCAAGTGCCCAGGCTTGGTCACCGGGAAGAACAACTCTCATCCCACAATTGCTGCAGAACTCTTCTCTCCCCATCATGGGCCACAGTGGGTCTCTTAATTTGATTGTGGGGTTCTTTTTGTGGGGAGGGGTGGTATAACTTTTCTTCAGAAGACCCATGTGGGACACCTCCAAGGCTGGCCTCCTCATAAGCCCTGCCTACACCATGTTCCAGTAAACCTCTCCACCAAGGAACTGTGTTCAGCTGCCACAGGCCTGGAGGAGTTTCCTGGCCTGTCACGTGAGGTTTGATCAGTAAACCAGTGCACGCTTGGCCACCCTTGCCATTTCTGCTCCCAGAGTCTCAGGCTCCCCTTCTGACCCAGTGTGCGCCCTTGACTGCTTTCTTTGCTGCCCTTCCAGGGAGCTGCCCCCCTGGTAGGGCATGTGCCTGTTTCCCTCTCAGCCTGGAGGCTGGCTGGACATCTCCTAGGGTCACTGTGCCTCTCAGCTAGTTGGCGGGGGTGCTGGACTGGACTCTTGTTCACTTTACCTTCTGCCAAATGCAGAGAGGGAGGCCAGTGTCAGGGTCGGAGTGGCCTGGCTCTTAGCACTGACCGACCATTGCCATTTCTGGCCTCGCTAGGCCCAGGAGAGGAGGGAGGCAAGCCAGTCGGGTTTCCTGGAGCAATGGGTGTGCCAGCCCTCAGCATGACTCTGCCAAGCATCCAGACCACAAATGCAGGAATTTGGCTGAGGAGCAGCTTTAGGTATGGATTGATGACTAAGTCAAGCTACTTCCTGAGCTTCTCTCAGATTTCCAAGAGCCAGAGATGAATTGTGCTGCATCTTGCCCCAATTCTTAGGATTTCTTTTCCTCCGCCACTGCAGTGATTGTTAGAGGTAGTTTTCTTGAATTAATATTAAATCACAGTTCCAGCCCTTGTTATTCTTGTCCTTAGTCCTCCAGGGGGAGCTGGGGTTGCAGGGCAACAGTACAGTCGCGCTTACGACCTGGCTAGAACACAAGGTCAGATGATAAACAGAAGCACAGGAACTCAGCCCATGGCCGCAAGCTGGTCAAGGCCTGCTCACTGTAAACATGGCTCTGTACCATTGAGTTTAACACAATTTTATTAGAAATTAGTGTTTGCTTCCATCACTTATGCTGAGCAACCAAATATTACAGTTATGTGATAAAGGAAAAATTCTTTCCTGCCCAGGACCTGCGCCATCCTTTAGGCCGACCTTGGTCACATACCAAATTCAATAAAACCCAATACTGGCCTGTGTTGTTAACAGCAGGCTGCCAGGTTTCTCAGAAACTGACAAGAAAATCTGACCTTCATCCATACTTTGTTTACTTACCCCTGGGCTGCTTGGAGTTGAAAAATGCACACAGCCAAGAGTTGCTTTCTGAATAGGGCTGGAAACTTTCAAAGAAAACCCCCAAACTTTTAAGTCACAAAGTCTGATTAAAGAAGCTAAGATCATGTCAGTGAGTTCAATGTTAGTATTTTCCTTAAGACCAAGGAGAGATTTTCAGTCAGAGAAGATAAATGCCCAGTCCCAGACTACTGTGCTTTCTCGGCAAAAAAGACTGAGACACTGAGGATGTGAATGTCAAAGTAGTAAGCAGGGACTAAAGGGGATGGGGAGGTCAAAAGGCAAGCATCACAACACCTCAGTGGGGAGCTGGGAATTTGAGTGTTAAAGGACCTCAAGAGGGCAGCTGAGAAAATAGGCCAGTGGTCTCAGGCTGACGCATTCCAGTCTCTGTGGGAAAGTCATAAAGCCAAAGCCTGAATTTGGCCAAAGAAGTGGATTTGTCTTTATCTTGTTACCTCAATGAGGGCTGGAAGAACTAGTAGCTGATCACCAAGGTACCTGACCTGAGAGTCTTAGTGCTGTTTATACATTCAAGACTGTGACTAACATAAAATGCCTAATTAGAAAGTCACATTTCCCCTGTCCCGCCGTCATGTCACTTCAGGTCCTTGTGTCTAACCCTGGGTCTGGCATTTGCCCATAGGCTCTGTGGCATCAGCTATCATAAGAGTAGTCAAGAGAGATGAACTTGATAACCTGTGTTCTCTCCAAAGAGCAGAAAGTGGGTACTATACGTGGCTACGTTGCTTTGTTAGGCTGGCAGAACAGTCCCTCCCTGACAGCATTCCTTTGGAAAATAATTCAGATAAGCTGAATTCTGGTTTGGCCAAGCCAAACAAAAAGGAATGAAAACCAAAGCCCTAAAG