Transcript asmbl_49347

Sequence
Transcript Sequence for observation asmbl_49347 of TGE0056266:
GTCCCGGTGCGCACGGACGTGGCTCGAGTTTCCTCTGCTCTCCGCTCTCGCCCGCTAGCTCTCCTCCCTTCCGCTCCTGCTTCTCTCCGGGTCTCCCGCTCCAGCTCCAGCCCCACCCGGCCGGTCCCGCACGGCTCCGGGTAGCCATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGGATGAAGTGAAGCTGCCGGCCAAACTGAGCATCAGCAAATCGCTGAAAGAGTCGGAGGCGCTGCCAGAGAAGGAGGGCGAGGAGCTGGGCGAGGGCGAGCGGCCCGAGGAGGACGCAGCGGCGCTGGAGCTTTCGTCGGACGAGGCGGTGGAGGTTGAGGAGGTTATTGAGGAGTCCCGCGCAGAGCGTATCAAGCGCAGCGGCCTGCGGCGCGTGGACGACTTCAAGAAGGCCTTCTCCAAGGAGAAGATGGAGAAGACCAAGGTGCGTACCCGCGAGAACCTGGAGAAGACGCGCCTCAAGACCAAGGAAAACCTGGAGAAGACGCGGCACACCCTGGAGAAGCGCATGAACAAGCTGGGCACGCGCCTGGTGCCCGCCGAGCGGCGCGAGAAACTGAAGACGTCGCGGGACAAGTTGCGCAAATCCTTCACGCCCGACCACGTGGTGTACGCGCGCTCCAAGACCGCGGTCTACAAGGTGCCACCCTTCACCTTCCACGTCAAGAAGATCCGCGAGGGCCAGGTGGAAGTGCTCAAGGCCACCGAGATGGTGGAGGTGGGCGCCGACGACGACGAGGGCGGCGCGGAGCGCGGGGAGGCCGGCGACCTGCGGCGCGGGAGCAGCCCCGACGTGCACGCGCTGCTGGAGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGACTGAGCCGCCCCCGCTGCCACCCACCCCATTCCTCGCTCCTTCCGAACTTCCTCTTTCGCATTCTCTCTCGGCTCGAGCTGGCTGAGATTTTTCTAAATTGAAAACACGCCCCCCTCCCCACACCTCCAGGAACTCCACTCCCAGTCTTAGAGCTGTTAGGACCCGATGGGGAGGCAGCCCCCGCAGTGGACAACCCCCGCTTGGACACAGTCCGAGTGGAATGGGAAGGGAATGGTCAATCCCTGTCCTGGTTGTCCAAGTCGGGATCTCAGAGGAAATTGCAGTGATTCCACGGTTAGGCCCCCCTGGGGGGGCTGCCTTCCCCTCAGCCTCTCCCCACACCACCCACCCAGCTGCTGTCATTCCGCTCACTGAGCTCTTCTTCATTCTCACCCTGATCCCTGGGGGACTCAAAGCCAAAACTGCCCAAAGAGGAAAGATTGAATCCTAAAGGGGATCCCTGCCCCCATGGGAGGCCCCCTACTAGAAGGACGTGAAAGCAGCTTTTGGGGGAAACTGAGGCAGTGGGGAAGACAGAGCAGAATGAGCCCTCACCCTGGCTGGGGGTCCAGCACAGGCTGTATCTGCAGAGGGTCCCAGAGGAACGCTGGAGCCAAGAGAAGCCCTGGGAAGGAGGGGTGGGGAACGACATGCATGTGAGGGATGGCACACTGATGTGTTTATGCACCTGTACACAGGAGCGCATGGCCATGGCTTTGGAAAGGAGAATGGAAAAATAGAAGAAGGTCGGCCGGGCTTGGTGGCTTATGCCTGTAACCCCAGCACTTTGGGAGGCCGAGGTGGGCGGATCAC