Transcript asmbl_48980

Sequence
Transcript Sequence for observation asmbl_48980 of TGE0000843:
GGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAGAATAATCATGTGAACGTG