Transcript asmbl_47860

Sequence
Transcript Sequence for observation asmbl_47860 of TGE0056255:
TTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGACCCCAATGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGATGGGCTGATCATCCGCAAGCCTGTGACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACATGGGCATAGGTAAGCGGAAGGGTACAGCCAATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGAGGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATCGATCGCCACATGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAAACAAGCGGATTCTCATGGAACACATCCACAAGCTGAAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGCCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAAAACCTCCCACTTTGTCTGTACATACTGGCCTCTGTGATTACATAGATCAGCCATTAAAATAAAACAAGCCTTAATCTGC