Transcript asmbl_43215

Sequence
Transcript Sequence for observation asmbl_43215 of TGE0056243:
GTGCCTTCCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGGCGCGAGTATGACCACAATGGCGGCCGCCACCCTGCTGCGCGCGACGCCCCACTTCAGCGGTCTCGCCGCCGGCCGGACCTTCCTGCTGCAGGGTCTGTTGCGGCTGCTGAAAGCCCCGGCATTGCCTCTCTTGTGCCGCGGCCTGGCCGTGGAGGCCAAGAAGACTTACGTGCGCGACAAGCCACATGTGAATGTGGGTACCATCGGCCATGTGGACCACGGGAAGACCACGCTGACTGCAGCCATCACGAAGATTCTAGCTGAGGGAGGTGGGGCTAAGTTCAAGAAGTACGAGGAGATTGACAATGCCCCGGAGGAGCGAGCTCGGGGTATCACCATCAATGCGGCTCATGTGGAGTATAGCACTGCCGCCCGCCACTACGCCCACACAGACTGCCCGGGTCATGCAGATTATGTTAAGAATATGATCACAGGCACTGCACCCCTCGACGGCTGCATCCTGGTGGTAGCAGCCAATGACGGCCCCATGCCCCAGACCCGAGAGCACTTATTACTGGCCAGACAGATTGGGGTGGAGCATGTGGTGGTGTATGTGAACAAGGCTGACGCTGTCCAGGACTCTGAGATGGTGGAACTGGTGGAACTGGAGATCCGGGAGCTGCTCACCGAGTTTGGCTATAAAGGGGAGGAGACCCCAGTCATCGTAGGCTCTGCTCTCTGTGCCCTTGAGGGTCGGGACCCTGAGTTAGGCCTGAAGTCTGTGCAGAAGCTACTGGATGCTGTGGACACTTACATCCCAGTGCCCGCCCGGGACCTGGAGAAGCCTTTCCTGCTGCCTGTGGAGGCGGTGTACTCCGTCCCTGGCCGTGGCACCGTGGTGACAGGTACACTAGAGCGTGGCATTTTAAAGAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGTTTGGGAAGCCAGTCTGGAGAGCAGGGCCTGGCTGAAGGGTGGCCTTACCCCGGCAGATCCCTTGTGCCTTCCCTCTGTCTCACATTCGCCTTCCTTCTCCCTGCTCCTTTTCCCTTTCCGTCCTAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTCACCCTGCGAGATGGCAACCGGACTATTGGCACCGGTCTAGTCACCAACACGCTGGCCATGACTGAGGAGGAGAAGAATATCAAATGGGGTTGAGTGTGCAGATCTCTGCTCAGCTTCCCTTGCGTTTAAGGCCTGCCCTAGCCAGGGCTCCCTCCTGCTTCCAGTACCCTCTCATGGCATAGGCTGCAACCCAGCAGAGGGCAGCTAGATGGACATTTCCCCTGCTCGGAAGGGTTGGCCTGCCTGGCTGGGGAGGTCAGTAAACTTTGAATAGTAAGCCA