Transcript asmbl_43213

Sequence
Transcript Sequence for observation asmbl_43213 of TGE0056243:
GTGCCTTCCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGGCGCGAGTATGACCACAATGGCGGCCGCCACCCTGCTGCGCGCGACGCCCCACTTCAGCGGTCTCGCCGCCGGCCGGACCTTCCTGCTGCAGGGTCTGTTGCGGCTGCTGAAAGCCCCGGCATTGCCTCTCTTGTGCCGCGGCCTGGCCGTGGAGGCCAAGAAGACTTACGTGCGCGACAAGCCACATGTGAATGTGGGTACCATCGGCCATGTGGACCACGGGAAGACCACGCTGACTGCAGCCATCACGAAGATTCTAGCTGAGGGAGGTGGGGCTAAGTTCAAGAAGTACGAGGAGATTGACAATGCCCCGGAGGAGCGAGCTCGGGGTATCACCATCAATGCGGCTCATGTGGAGTATAGCACTGCCGCCCGCCACTACGCCCACACAGACTGCCCGGGTCATGCAGATTATGTTAAGAATATGATCACAGGCACTGCACCCCTCGACGGCTGCATCCTGGTGGTAGCAGCCAATGACGGCCCCATGCCCCAGACCCGAGAGCACTTATTACTGGCCAGACAGATTGGGGTGGAGCATGTGGTGGTGTATGTGAACAAGGCTGACGCTGTCCAGGACTCTGAGATGGTGGAACTGGTGGAACTGGAGATCCGGGAGCTGCTCACCGAGTTTGGCTATAAAGGGGAGGAGACCCCAGTCATCGTAGGCTCTGCTCTCTGTGCCCTTGAGGTGAACGCGGGGTCAGGCAGGGCAGCTGCTGCAGAGGGTGGGGCTGGATGGGCACCCAGAGCTCTGCTTTGTGTCTGGGAAGTGGCTCTTGATAATCGAGGGAAGTAGAATGGGGATTTCAGAGTCCTGGCACTTCCCCTCAACAGGGTCGGGACCCTGAGTTAGGCCTGAAGTCTGTGCAGAAGCTACTGGATGCTGTGGACACTTACATCCCAGTGCCCGCCCGGGACCTGGAGAAGCCTTTCCTGCTGCCTGTGGAGGCGGTGTACTCCGTCCCTGGCCGTGGCACCGTGGTGACAGGTACACTAGAGCGTGGCATTTTAAAGAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTCACCCTGCGAGATGGCAACCGGACTATTGGCACCGGTCTAGTCACCAACACGCTGGCCATGACTGAGGAGGAGAAGAATATCAAATGGGGTTGAGTGTGCAGATCTCTGCTCAGCTTCCCTTGCGTTTAAGGCCTGCCCTAGCCAGGGCTCCCTCCTGCTTCCAGTACCCTCTCATGGCATAGGCTGCAACCCAGCAGAGGGCAGCTAGATGGACATTTCCCCTGCTCGGAAGGGTTGGCCTGCCTGGCTGGGGAGGTCAGTAAACTTTGAATAGTAAGCCA