Transcript asmbl_22599

Sequence
Transcript Sequence for observation asmbl_22599 of TGE0056176:
GTGGCTGACGGCAACGCCGCTGCTCTTGGAGAGGTCACTCCGGAGACGGCGTTGGTTTTGGGGTGTGGGGGGTTGGTGGCACTATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTCGAGGCTCGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCTGGCCCGGCTCCCGCTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTGTGCGGCTGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTGGGGTCGCCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAGGTTCCATTGCCTTCTCTTTCCCCCACAATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAGAGGGGGACAAAATCAATGAAGGTGACCTAATTGCAGAGGTTGAAACTGATAAAGCCACTGTTGGATTTGAGAGCCTGGAGGAGTGTTATATGGCAAAGATACTTGTTGCTGAAGGTACCAGGGATGTTCCCATCGGAGCGATCATCTGTATCACAGTTGGCAAGCCTGAGGATATTGAGGCCTTTAAAAATTATACACTGGATTCCTCAGCAGCACCTACCCCACAAGCGGCCCCAGCACCAACCCCTGCTGCCACTGCTTCGCCACCTACACCTTCTGCTCAGGCTCCTGGTAGCTCATATCCCCCTCACATGCAGGTACTTCTTCCTGCCCTCTCTCCCACCATGACCATGGGCACAGTTCAGAGATGGGAAAAAAAAGTGGGTGAGAAGCTAAGTGAAGGAGACTTACTGGCAGAGATAGAAACTGACAAAGCCACTATAGGTTTTGAAGTACAGGAAGAAGGTTATCTGGCAAAAATCCTGGTCCCTGAAGGCACAAGAGATGTCCCTCTAGGAACCCCACTCTGTATCATTGTAGAAAAAGAGGCAGATATATCAGCATTTGCTGACTATAGGCCAACCGAAGTAACAGATTTAAAACCACAAGTGCCACCACCTACCCCACCCCCGGTGGCCGCTGTTCCTCCAACTCCCCAGCCTTTAGCTCCTACACCTTCAGCACCCTGCCCAGCTACTCCTGCTGGACCAAAGGGAAGGGTGTTTGTTAGCCCTCTTGCAAAGAAGTTGGCAGTAGAGAAAGGGATTGATCTTACACAAGTAAAAGGGACAGGACCAGATGGTAGAATCACCAAGAAGGATATCGACTCTTTTGTGCCTAGTAAAGTTGCTCCTGCTCCGGCAGCTGTTGTGCCTCCCACAGGTCCTGGAATGGCACCAGTTCCTACAGGTGTCTTCACAGATATCCCAATCAGCAACATTCGTCGGGTTATTGCACAGCGATTAATGCAATCAAAGCAAACCATACCTCATTATTACCTTTCTATCGATGTAAATATGGGAGAAGTTTTGTTGGTACGGAAAGAACTTAATAAGATATTAGAAGGGAGAAGCAAAATTTCTGTCAATGACTTCATCATAAAAGCTTCAGCTTTGGCATGTTTAAAAGTTCCCGAAGCAAATTCTTCTTGGATGGACACAGTTATAAGACAAAATCATGTTGTTGATGTCAGTGTTGCGGTCAGTACTCCTGCAGGACTCATCACACCTATTGTGTTTAATGCACATATAAAAGGAGTGGAAACCATTGCTAATGATGTTGTTTCTTTAGCAACCAAAGCAAGAGAGGGTAAACTACAGCCACATGAATTCCAGGGTGGCACTTTTACGATCTCCAATTTAGGAATGTTTGGAATTAAGAATTTCTCTGCTATTATTAACCCACCTCAAGCATGTATTTTGGCAATTGGTGCTTCAGAGGATAAACTGGTCCCTGCAGATAATGAAAAAGGGTTTGATGTGGCTAGCATGATGTCTGTTACACTCAGTTGTGATCACCGGGTGGTGGATGGAGCAGTTGGAGCCCAGTGGCTTGCTGAGTTTAGAAAGTACCTTGAAAAACCTATCACTATGTTGTTGTAACTAACTCAAGAATTTCTAAACTCTCCCAGGTCACACTGATTCATTCTTAACAAGATATTTATATGTTATTAAACAGGTGGTTCTTTTTATTTTAACCAGTTATTTTTATTATTGAGTCTGTCCAGATAAGTTATTTATAATGGGCATTACTGAATTTTTAAAATGCCGATTACACCCAAATATTGTGCACATTTAATAATCAGACACCAGATTTTTAGCTCTGTACTCCTAATTAAGGGACATGTATGTGGCCTTGCCTAGCCCTTTGGTGATAAGTACTTCCTCTAGGAAATGTACGATAGGTAGAATTGTGGTTCCCTAAAGACAAGTACATAAAGGTGACCCTGATGAAACCTTGAAGTTCTGAAATTTAACTGCCTAAAATGTTCTCCTTAGATGTGAGAGAAAGAGAAATCAGAAAAATTAATTCTCTTGGGGGAAGGGCTTGAATTGAAGCTTTACTTTAGAATTTAGCCCTGGTTTGAAATTTTCCATTACATGATCTTGGTTTATCATCGATGGGAAGGGTAGAAAACTTCAAGGAAAATAAGTGAAATTTTAAAAGTCAGCATTTTCTTAGACCTCTTCAGCTGATTGTTTATTTTTCTATGAATTCCTACACATGGTTATTCCCCCCTACTTGAGATAATCTAAATATAAACCAGCTACTTGATGTAACTGAGAATTTGTGTGGATATTTATTTAAACAAATGTGTAATTTTGAGTACAGAATTCAACAGTTACCTCCAAAAAAGAAACATTGTTAATATAATTTAACAGAAGTTGTGAAACTAAAATTTTCTAAGATTAACTGGTAGTTCATTGTAAATGAACATAATGAACAGAATTTATGACTCCACTGTGGAAAATGCTATCAAATAACTAAGGAATATATATGGAATAAGTGTACATATGTAAAATATTGTTACTAGAGTTAGATATGTGCCAAAGTCCATTTATCCCAAATCCTGTCTGAAAAGGAGGGGTACATTGGTAAACATTTTGGAGTGCTTAAAAATGCCAAAAACAAAATGGTAATTTCTACTTTGATAAAGTAAAAAAGTTAAATGTGTGTAAAAAAGTGTTCTGTGTCCTTCTACTCCAGCATCGTCTCATGTAAAATAAGAAAGCCCTAAAATACTATTGGAGAGAAAAAATTAACTAGGTTGCTACTTTATTTGCCTAAATACTTTTTTCTATTTTGTTAGATTTTGCCTTTCTTTTGGAAGGAAGGAGGCGATATTCTGGATTATAAAAATGAATTGGGAACATTATCACAATTCCAGACTTTCTATTAATATTTATGTGTTTTAATAAACGTTTGAAATTATTTATGACTACTTAAAATGAATCTGACCAGTGCTTCCTGGTATATGTAATATGTGGAGTTAGCCCCTGAAATTTGCTTTAAGTGTTTCAGTGTTGAATCTGTTTCTAAATATTCATTATTACATGGTACACAAGTGACACTCCATATATTCCACACAGACTTTTACCTTGCTGTATTATTATGAAAACAATACATTAATTTGATTTTTCAGTAATTAGTAATTTTAGGTTGAAGATTATCCAAAAGAAACAAGCTTATCACAAGGGACCATCATCAATATGATCCAAATCTGGTTCAAACATTCAAAACTTCAAAGATAATTCATCTTTCGCTAATGCTTGTGGTTCTGTTGTTCCCTTGAAAAAAAATAAAAACAGTTGCCTTCTAATAAACATTGTTGAGTTAAAAATTAATCTGAG