Transcript asmbl_25540

Sequence
Transcript Sequence for observation asmbl_25540 of TGE0000857:
GGAGGGTGGTGCTGGGTTTTTCTTTATCGGCTTGGGTGTGGAATCGCGGACTGCGCCCCTCCAATCTGATCTGGAGAGTGGCTGACTGCGTGTGCAGAGCTCTGGGGGTGTTGGTCTGGGATTGTGCCATCAGCTTTGCAAGCAAGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGCGCGCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGCAGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATGGAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAGTGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGCCACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGGCGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTGGCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCACGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCATGACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGACAAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCTGCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTCACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGCACTTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCACTCGCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTCGGGCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAGCCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTGGTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAACAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTGAGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACTGAGGAGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGCTCTCCTGGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCTGTGCACACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAAAGAGACGAATACAATTTTCTAACTCAGCAAA