Transcript asmbl_12958

Sequence
Transcript Sequence for observation asmbl_12958 of TGE0056143:
CACAGTCTGTCTCTTCGCCGGTTCCCGGCCCCGTGGATCCTACTTCTCTGTCGCCCGCGGTTCGCCGCCCCGCTCGCCGCCGCGATGCCAGTGTTTCATACGCGCACGATCGAGAGCATCCTGGAGCCGGTGGCACAGCAGATCTCCCACCTGGTGATAATGCACGAGGAGGGCGAGGTGGACGGCAAAGCCATTCCTGACCTCACCGCGCCCGTGGCCGCCGTGCAGGCGGCCGTCAGCAACCTCGTCCGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGAAAGAGTTGCTGCCAGTTCTCATTTCAGCTATGAAGATTTTTGTAACAACTAAAAACTCAAAAAACCAAGGCATAGAGGAAGCTTTAAAAAATCGCAATTTTACTGTAGAAAAAATGAGTGCTGAAATTAATGAGATAATTCGTGTGTTACAACTCACCTCTTGGGATGAAGATGCCTGGGCCAGCAAGGACACTGAAGCCATGAAGAGAGCATTGGCCTCCATAGACTCCAAACTGAACCAGGCCAAAGGTTGGCTCCGTGACCCTAGTGCCTCCCCAGGGGATGCTGGTGAGCAGGCCATCAGACAGATCTTAGATGAAGCTGGAAAAGTTGGTGAACTCTGTGCAGGCAAAGAACGCAGGGAGATTCTGGGAACTTGCAAAATGCTAGGGCAGATGACTGATCAAGTGGCTGACCTCCGTGCCAGAGGACAAGGATCCTCACCGGTGGCCATGCAGAAAGCTCAGCAGGTATCTCAGGGTCTGGATGTGCTCACAGCAAAAGTGGAAAATGCAGCTCGCAAGCTGGAAGCCATGACCAACTCAAAGCAGAGCATTGCAAAGAAGATCGATGCTGCTCAGAACTGGCTTGCAGATCCAAATGGTGGACCGGAAGGAGAAGAGCAGATTCGAGGTGCTTTGGCTGAAGCTCGGAAAATAGCAGAATTATGTGATGATCCTAAAGAAAGAGATGACATTCTACGTTCCCTTGGGGAAATATCTGCTCTGACTTCTAAATTAGCAGATCTACGAAGACAGGGGAAAGGAGATTCTCCAGAGGCTCGAGCCTTGGCCAAACAGGTGGCCACGGCCCTGCAGAACCTGCAGACCAAAACCAACCGGGCTGTGGCCAACAGCAGACCGGCCAAAGCAGCTGTACACCTTGAGGGCAAGATTGAGCAAGCACAGCGGTGGATTGATAATCCCACAGTGGATGACCGTGGAGTCGGTCAGGCTGCCATCCGGGGGCTTGTGGCCGAAGGGCATCGTCTGGCTAATGTTATGATGGGGCCTTATCGGCAAGATCTTCTCGCCAAGTGTGACCGAGTGGACCAGCTGACAGCCCAGCTGGCTGACCTGGCTGCCAGAGGGGAAGGGGAGAGTCCTCAGGCACGAGCACTTGCATCTCAGCTCCAAGACTCCTTAAAGGATCTAAAAGCTCGGATGCAGGAGGCCATGACTCAGGAAGTGTCAGATGTTTTCAGCGATACCACAACTCCCATCAAGCTGTTGGCAGTGGCAGCCACGGCGCCTCCTGATGCGCCTAACAGGGAAGAGGTATTTGATGAGAGGGCAGCTAACTTTGAAAACCATTCAGGAAAGCTTGGTGCTACGGCCGAGAAGGCGGCTGCGGTTGGTACTGCTAATAAATCAACAGTGGAAGGCATTCAGGCCTCAGTGAAGACGGCCCGAGAACTCACACCCCAGGTGGTCTCGGCTGCTCGTATCTTACTTAGGAACCCTGGAAATCAAGCTGCTTATGAACATTTTGAGACCATGAAGAACCAGTGGATCGATAATGTTGAAAAAATGACAGGGCTGGTGGACGAAGCCATTGATACCAAATCTCTGTTGGATGCTTCAGAAGAAGCAATTAAAAAAGACCTGGACAAGTGCAAGGTAGCTATGGCCAACATTCAGCCTCAGATGCTGGTTGCTGGGGCAACCAGTATTGCTCGTCGGGCCAACCGGATCCTGCTGGTGGCTAAGAGGGAGGTGGAGAATTCCGAGGATCCCAAGTTCCGTGAGGCTGTGAAAGCTGCCTCTGATGAATTGAGCAAAACCATCTCCCCGATGGTGATGGATGCAAAAGCTGTGGCTGGAAACATTTCCGACCCTGGACTGCAAAAGAGCTTCCTGGACTCAGGATATCGGATCCTGGGAGCTGTGGCCAAGGTCAGAGAAGCCTTCCAACCTCAGGAGCCTGACTTCCCGCCGCCTCCACCAGACCTTGAACAACTCCGACTAACAGATGAGCTTGCTCCTCCCAAACCACCTCTGCCTGAAGGTGAGGTCCCTCCACCTAGGCCTCCACCACCAGAGGAAAAGGATGAAGAGTTCCCTGAGCAGAAGGCCGGGGAGGTGATTAACCAGCCAATGATGATGGCTGCCAGACAGCTCCATGATGAAGCTCGCAAATGGTCCAGCAAGCCGGGCATCCCAGCCGCTGAGGTGGGTATAGGTGTTGTAGCTGAGGCAGATGCGGCCGATGCTGCTGGCTTCCCTGTCCCCCCTGACATGGAAGACGATTACGAACCTGAGCTGCTGTTAATGCCATCCAATCAGCCGGTCAACCAGCCCATTCTGGCCGCGGCTCAGTCCTTGCATCGGGAAGCTACCAAGTGGTCTAGTAAGGGCAATGACATCATTGCAGCAGCCAAGCGCATGGCTCTGCTGATGGCTGAGATGTCTCGGCTGGTAAGAGGGGGCAGTGGTACCAAGCGGGCACTCATTCAGTGTGCCAAGGACATCGCCAAGGCCTCAGATGAGGTGACTCGGTTGGCCAAGGAGGTTGCCAAGCAGTGCACAGATAAACGGATTAGAACCAACCTCTTACAGGTATGTGAGCGAATCCCAACCATAAGCACCCAGCTCAAAATCCTGTCCACAGTGAAGGCCACCATGCTGGGCCGGACCAACATCAGTGATGAGGAGTCTGAGCAGGCCACAGAGATGCTGGTTCACAATGCCCAGAACCTCATGCAGTCTGTGAAGGAGACTGTGCGGGAAGCTGAAGCTGCTTCAATCAAAATTCGAACAGATGCTGGATTTACACTGCGCTGGGTTAGAAAGACTCCCTGGTACCAGTAGGCACCTGGCTGAGCCTGGCTGGCACAGAAACCTCTACTAAAAAGAAGGAAAATGATCTGAGTCCCAGGAGCTGCCCAGAGTTGCTGGGAGCTGAAAAATCACATCCTGGCCTGGCACATCAGAAAGGAATGGGGGCCTCTTCAAATTAGAAGACATTTATACTCTTTTTTCATGGACACTTTGAAATGTGTTTCTGTATAAAGCCTGTATTCTCAAACACAGTTACACTTGTGCACCCTCTATCCCAATAGGCAGACTGGGTTTCTAGCCCATGGACTTCACATAAGCTCAGAATCCAAGTGAACACTAGCCAGACACTCTGCTCTGCCCTTGTTCCCTAGGGGACACTTCCCTCTGTTTCTCTTTCCTTGGCTCCCATTCACTCTTCCAGAATCCCAAGACCCAGGGCCCAGGCAAATCAGTTACTAAGAAGAAAATTGCTGTGCCTCCCAAAATTGTTTTGAGCTTTCCATGTTGCTGCCAACCATACCTTCCTTCCCTGGGCTGTGCTACCTGGGTCCTTTTCAGAAGTGAGCTTTGCTGCTACAGGGGAAGGTGGCCTCTGTGGAGCCCCAGCATATGGGGGCCTGGATTCATTTCCTGCCCTTCCTCAGTTTAATCCTTCTAGTTTCCCACAATATAAAACTGTACTTCACTGTCAGGAAGAAATCACAGAATCATATGATTCTGCTTTTACCATGCCCCTGAGCAATGTCTGTGCTAGGGAAACTTCCCGTCCCATATCCTGCCTCAGCCCGCCAAGGTAGCCATCCCATGAACACACTGTGTCCTGGTGCTCTCTGCCACTGGAAGGGCAGAGTAGCCAGGGTGTGGCCCTGCCATCTTCCCAGCAGGGCCACTCCCGGCACTCCATGCTTAGTCACTGCCTGCAGAGGTCTGTGCTGAGGCCTTATCATTCATTCTTAGCTCTTAATTGTTCATTTTGAGCTGAAATGCTGCATTTTAATTTTAACCAAAACATGTCTCCTATCCTGGTTTTTGTAGCCTTCCTCCACATCCTTTCTAAACAAGATTTTAAAGACATGTAGGTGTTTGTTCATCTGTAACTCTAAAAGATCCTTTTTAAATTCAGTCCTAAGAAAGAGGAGTGCTTGTCCCCTAAGAGTGTTTAATGGCAAGGCAGCCCTGTCTGAAGGACACTTCCTGCCTAAGGGAGAGTGGTATTTGCAGACTAGAATTCTAGTGCTGCTGAAGATGAATCAATGGGAAATACTACTCCTGTAATTCCTACCTCCCTGCAACCAACTACAACCAAGCTCTCTGCATCTACTCCCAAGTATGGGGTTCAAGAGAGTAATGGGTTTCATATTTCTTATCACCACAGTAAGTTCCTACTAGGCAAAATGAGAGGGCAGTGTTTCCTTTTTGGTACTTATTACTGCTAAGTATTTCCCAGCACATGAAACCTTATTTTTTCCCAAAGCCAGAACCAGATGAGTAAAGGAGTAAGAACCTTGCCTGAACATCCTTCCTTCCCACCCATCGCTGTGTGTTAGTTCCCAACATCGAATGTGTACAACTTAAGTTGGTCCTTTACACTCAGGCTTTCACTATTTCCTTTATAATGAGGATGATTATTTTCAAGGCCCTCAGCATATTTGTATAGTTGCTTGCCTGATATAAATGCAATATTAATGCCTTTAAAGTATGAATCTATGCCAAAGATCACTTGTTGTTTTACTAAAGAAAGATTACTTAGAGGAAATAAGAAAAATCATGTTTGCTCTCCCGGTTCTTCCAGTGGTTTGAGACACTGGTTTACACTTTATGCCGGATGTGCTTTTCTCCAATATCAGTGCTCGAGACACAGTGAAGCAAATT