Transcript asmbl_105644

Sequence
Transcript Sequence for observation asmbl_105644 of TGE0056080:
AACGGGTCCGTGCGGTCACGCCTGACTGCCTGTCTCCGGGTCAAGGCTGCCAGGACCAGCTCCAGCCCTCCGCCCGAGAAGGCTGTCCTTTCCCCTCGGAACTCTGGCTTCCCTAAAGCGGCCGCGCCTCCTTCCAGGCCTCACCTCCTGCCGGCTCCGCCCGGCCCGGCCCACCTCGCCCCCACCTCGGCGCCCACCCATTGTCCCCTCGCGCAGTCACCGAGCGCAGATCCCGCGCTCTCGATTGGAACGCCTCCCCATCACTCAGCCACACTCAGGGGCTGGACGCCTCACTCCCGTTTCCGAGCCATAAAAGGTCTAGGACCGCTTCCCCCGAGCCAGCAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAATACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATGAAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAACCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTGAGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAAGGAGGGGAAAATTAACCGGCCTTCCAACTTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGCTGTCCCACAAATAGTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATTTCCCATGTGGTTTTTATGTTTAATATTAGGGGAGTAGAGCCAGTTAACATTTAGGGAGTTATCTGTTTTCATCTTGAGGTGGCCAATATGGGGATGTGGAATTTTTATACAAGTTATAAGTGTTTGGCATAGTACTTTTGGTACATTGTGGCTTCAAAAGGGCCAGTGTAAAACTGCTTCCATGTCTAAGCAAAGAAAACTGCCTACATACTGGTTTGTCCTGGCGGGGAATAAAAGGGATCATTGGTTCCAGTCACAGGTGTAGTAATTGTGGGTACTTTAAGGTTTGGAGCACTTACAAGGCTGTGGTAGAATCATACCCCATGGATACCACATATTAAACCATGTATATCTGTGGAATACTCAATGTGTACACCTTTGACTACAGCTGCAGAAGTGTTCCTTTAGACAAAGTTGTGACCCATTTTACTCTGGATAAGGGCAGAAACGGTTCACATTCCATTATTTGTAAAGTTACCTGCTGTTAGCTTTCATTATTTTTGCTACACTCATTTTATTTGTATTTAAATGTTTTAGGCAACCTAAGAACAAATGTAAAAGTAAAGATGCAGGAAAAATGAATTGCTTGGTATTCATTACTTCATGTATATCAAGCACAGCAGTAAAACAAAAACCCATGTATTTAACTTTTT