Transcript asmbl_25539

Sequence
Transcript Sequence for observation asmbl_25539 of TGE0000857:
CAGCCCGGGACCTAATCCCCAAAACCTGGGCTGTAGGGAGCAGAGGTCCAGAGGACGCCACACCCCACATTTGAATATTTTTTTTTCTTGTCACGCAAACTTCCTGGGCAGGAACTCCAAGGGCTCAATGGACGGGAAGCAGGGTCCTTAAATACGTCCCCTCTTGGCTCTTGCCGTTCCAGGAGCCCCAGTTACCGGGAGAGGCTGTGTCAAAGGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGCGCGCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGCAGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATGGAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAGTGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGCCACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGGCGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTGGCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCACGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCATGACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGACAAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCTGCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTCACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGCACTTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCACTCGCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTCGGGCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAGCCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTGGTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAACAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTGAGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACTGAGGAGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGCTCTCCTGGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCTGTGCACACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAAAGAGACGAATACAATTTTCTAACTCAGCAAA