Transcript asmbl_105642

Sequence
Transcript Sequence for observation asmbl_105642 of TGE0056080:
AACGGGTCCGTGCGGTCACGCCTGACTGCCTGTCTCCGGGTCAAGGCTGCCAGGACCAGCTCCAGCCCTCCGCCCGAGAAGGCTGTCCTTTCCCCTCGGAACTCTGGCTTCCCTAAAGCGGCCGCGCCTCCTTCCAGGCCTCACCTCCTGCCGGCTCCGCCCGGCCCGGCCCACCTCGCCCCCACCTCGGCGCCCACCCATTGTCCCCTCGCGCAGTCACCGAGCGCAGATCCCGCGCTCTCGATTGGAACGCCTCCCCATCACTCAGCCACACTCAGGGGCTGGACGCCTCACTCCCGTTTCCGAGCCATAAAAGGTCTAGGACCGCTTCCCCCGAGCCAGCAGCAGCGTTTGACGTCATCGTGCGTGTGGTGCCCCTGCTGCCGGGGCTGGTGATTGGAGGAAACCCCGTGTCTGCGGAGCGGCTGTAGCCTGTGAGCAGCGAGATCCAGGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAATACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATGAAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAACCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTGAGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAAGGAGGGGAAAATTAACCGGCCTTCCAACTTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGCTGTCCCACAAATAGTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATTTCCCATGTGGTTTTTATGTTTAATATTAGGGGAGTAGAGCCAGTTAACATTTAGGGAGTTATCTGTTTTCATCTTGAGGTGGCCAATATGGGGATGTGGAATTTTTATACAAGTTATAAGTGTTTGGCATAGTACTTTTGGTACATTGTGGCTTCAAAAGGGCCAGTGTAAAACTGCTTCCATGTCTAAGCAAAGAAAACTGCCTACATACTGGTTTGTCCTGGCGGGGAATAAAAGGGATCATTGGTTCCAGTCACAGGTGTAGTAATTGTGGGTACTTTAAGGTTTGGAGCACTTACAAGGCTGTGGTAGAATCATACCCCATGGATACCACATATTAAACCATGTATATCTGTGGAATACTCAATGTGTACACCTTTGACTACAGCTGCAGAAGTGTTCCTTTAGACAAAGTTGTGACCCATTTTACTCTGGATAAGGGCAGAAACGGTTCACATTCCATTATTTGTAAAGTTACCTGCTGTTAGCTTTCATTATTTTTGCTACACTCATTTTATTTGTATTTAAATGTTTTAGGCAACCTAAGAACAAATGTAAAAGTAAAGATGCAGGAAAAATGAATTGCTTGGTATTCATTACTTCATGTATATCAAGCACAGCAGTAAAACAAAAACCCATGTATTTAACTTTTT