Transcript asmbl_105641

Sequence
Transcript Sequence for observation asmbl_105641 of TGE0056080:
GGACGCGCGCGCCTCCGCTCGCCCTCCAGCGCGGGCGGGCAGGACGAGCGCCGGGGAGCGGCGGTTACGCGGGGCCCCGATCGCTGTGGGCACCAATCAACGGTTGCCATAGCAGCGTTTGACGTCATCGTGCGTGTGGTGCCCCTGCTGCCGGGGCTGGTGATTGGAGGAAACCCCGTGTCTGCGGAGCGGCTGTAGCCTGTGAGCAGCGAGATCCAGGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAATACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATGAAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAACCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTGAGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAAGGAGGGGAAAATTAACCGGCCTTCCAACTTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGCTGTCCCACAAATAGTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATTTCCCATGTGGTTTTTATGTTTAATATTAGGGGAGTAGAGCCAGTTAACATTTAGGGAGTTATCTGTTTTCATCTTGAGGTGGCCAATATGGGGATGTGGAATTTTTATACAAGTTATAAGTGTTTGGCATAGTACTTTTGGTACATTGTGGCTTCAAAAGGGCCAGTGTAAAACTGCTTCCATGTCTAAGCAAAGAAAACTGCCTACATACTGGTTTGTCCTGGCGGGGAATAAAAGGGATCATTGGTTCCAGTCACAGGTGTAGTAATTGTGGGTACTTTAAGGTTTGGAGCACTTACAAGGCTGTGGTAGAATCATACCCCATGGATACCACATATTAAACCATGTATATCTGTGGAATACTCAATGTGTACACCTTTGACTACAGCTGCAGAAGTGTTCCTTTAGACAAAGTTGTGACCCATTTTACTCTGGATAAGGGCAGAAACGGTTCACATTCCATTATTTGTAAAGTTACCTGCTGTTAGCTTTCATTATTTTTGCTACACTCATTTTATTTGTATTTAAATGTTTTAGGCAACCTAAGAACAAATGTAAAAGTAAAGATGCAGGAAAAATGAATTGCTTGGTATTCATTACTTCATGTATATCAAGCACAGCAGTAAAACAAAAACCCATGTATTTAACTTTTT