Transcript asmbl_105545

Sequence
Transcript Sequence for observation asmbl_105545 of TGE0056079:
TCCTGAAAACTGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAAGCCAAGGGACGTTGACCTGGACTGAAGTTCGCATTGAACTCTACAACATTCTGTGGGATATATTGTTCAAAAAGATATTGTTGTTTTCCATGATTTAGCAAGCAACTAATTTTCTCCCAAGCTGATTTTATTCAATATGGTTACGTTGGTTAAATAAACTTTTTTTAGATTTAGAAGGTGATGTAATGATGTATTCATTGTGCTTATGATGTATTCTTAGTCATAACTGAGTGAAGGAAATGGGAAATTTGCATTATTTCTTTGTTCTGATATGAATAATAACATATTTCATAATAATTCAAGGTAAAAAGGGATATCTATGGATTTCCCTAGGTAGGAGATAACAAGTATGTACCATTACTGAATATTAAATCCTTCTTTACCATAGCTACAGTTAAGTAGGTGTATCTCAGAAACCTAAGGTAGTTTTAAATGTAGTGAAATTGTCCACAGCAAGCTGGCCCAAGTGCTCACATTTTATACCCGCTCTGTCTTAGTGCGTTGCAAGAGAGGAGTATATACAGTAGTTCCCCCTTATCCACAGGGGTACATTCTAAGACCCCCGGTGGGTGACTGAAACCACAGATAGTACCGAATCTTATACATACTATGTTTTTTTTCTAAACATAAATACCTACAATAAAGTTTAATTTTTAAATTAGGCACCATAATTAATAATAAAACAGAACAGTTATAACAATATACTATAATAAAATTATGTGTATGTGATCTCTCTTTCTCTCTCCCTCTCAAAATATTTTTAATATCTCTCCAGAATTCAGTGCAAATAATTCCATCATACTCACTTCAGAAAAGTGAAGATAGTCTTGTACATGAGTAGATTCAAATTTTATTGTCGTGGTTTCCAAAGTTTTATTTTTCTCACCAATGGAACTTTTGATTCAAATAAAATATCCAAGGGATTTCAGCTTATAAAACACACAAAATTGATAATGAGTTTTCCAAGGTACTGTGTGTGTGAATGTGTATGTCTGTGTATGTGTGTGTCGTCTGTATGTTTTTCCCACCTCTTGTAGAAGCTACGAAGCACCTTTCCATATTATTGAGGTTTCCTGTACGTAGACTGAAATTTACAAATCACATGCTTACATTTTATAGTAAGACAAAATCTGCCAAAGTGTATATTGCTGTTGATATAATTCTGTTTGTGATTCTCTCTTTAAAAATAAATCCAAAGGTTTTCATTTCCTGCATACTTATCCTATGCATAACACCATGATATGCAGAGGCCAGAAGAGATGGACTAGTTCACTGACCATAAGAATTTAC