Transcript asmbl_25533

Sequence
Transcript Sequence for observation asmbl_25533 of TGE0000855:
GCGCCAAGTTCGGGGTTTGGGGTTGGAGCGGCTGGTCACGTGGCTGGCCCGCGGCGGTGCGCGGGGCGTTGGGTCAGCGGGTCTGGGACTGGTGGCACCGGCGGCGGCGTAGGACGGAGGCGTCGCTAGGCAGCTTCGAACCAGTGCAATGACGATGCCAGTCAACGGGGCCCACAAGGATGCTGACCTGTGGTCCTCACATGACAAGATGCTGGCACAACCCCTCAAAGACAGTGATGTTGAGGTTTACAACATCATTAAGAAGGAGAGTAACCGGCAGAGGGTTGGATTGGAGCTGATTGCCTCGGAGAATTTCGCCAGCCGAGCAGTTTTGGAGGCCCTAGGCTCTTGCTTAAATAACAAATACTCTGAGGGGTACCCGGGCCAGAGATACTATGGCGGGACTGAGTTTATTGATGAACTGGAGACCCTCTGTCAGAAGCGAGCCCTGCAGGCCTATAAGCTGGACCCACAGTGCTGGGGGGTCAACGTCCAGCCCTACTCAGGCTCCCCTGCAAACTTTGCTGTGTACACTGCCCTGGTGGAACCCCATGGGCGCATCATGGGCCTGGACCTTCCGGATGGGGGCCACCTGACCCATGGGTTCATGACAGACAAGAAGAAAATCTCTGCCACGTCCATCTTCTTTGAATCTATGCCCTACAAGGTGAACCCAGATACTGGCTACATCAACTATGACCAGCTGGAGGAGAACGCACGCCTCTTCCACCCGAAGCTGATCATCGCAGGAACCAGCTGCTACTCCCGAAACCTGGAATATGCCCGGCTACGGAAGATTGCAGATGAGAACGGGGCGTATCTCATGGCGGACATGGCTCACATCAGCGGGCTGGTGGCGGCTGGCGTGGTGCCCTCCCCATTTGAACACTGCCATGTGGTGACCACCACCACTCACAAGACCCTGCGAGGCTGCCGAGCTGGCATGATCTTCTACAGGAAAGGAGTGAAAAGTGTGGATCCCAAGACTGGCAAAGAGATTCTGTACAACCTGGAGTCTCTTATCAATTCTGCTGTGTTCCCTGGCCTGCAGGGAGGTCCCCACAACCACGCCATTGCTGGGGTTGCTGTGGCACTGAAGCAAGCTATGACTCTGGAATTTAAAGTTTATCAACACCAGGTGGTGGCCAACTGCAGGGCTCTGTCTGAGGCCCTGACGGAGCTGGGCTACAAAATAGTCACAGGTGGTTCTGACAACCATTTGATCCTTGTGGATCTCCGTTCCAAAGGCACAGATGGTGGAAGGGCTGAGAAGGTGCTAGAAGCCTGTTCTATTGCCTGCAACAAGAACACCTGTCCAGGTGACAGAAGCGCTCTGCGGCCCAGTGGACTGCGGCTGGGGACCCCAGCACTGACGTCCCGTGGACTTTTGGAAAAAGACTTCCAAAAAGTAGCCCACTTTATTCACAGAGGGATAGAGCTGACCCTGCAGATCCAGAGCGACACTGGTGTCAGAGCCACCCTGAAAGAGTTCAAGGAGAGACTGGCAGGGGATAAGTACCAGGCGGCCGTGCAGGCTCTCCGGGAGGAGGTTGAGAGCTTCGCCTCTCTCTTCCCTCTGCCTGGCCTGCCTGACTTCTAAAGGAGCGGGCCCACTCTGGACCCACCTGGCGCCACAGAGGAAGCTGCCTGCCGGAGGACCCCCACCTGAGAGATGGATGAGCTGCTCCAAAGGGGAACTGTTGACACTCGGGCCCTTTGAGGGGGTTTCTTTTGGACTTTTTTCATGTTTTCTTCACAAATCAAAATTTGTTTAAGTCTCATTGTTAGTAATTCTGGGACAGGTTATTAAAGGATTTAAATTTGAACCTGGCTTTCTCACAGCTGGACATAATTCTAGGAAAATAAAATACTATGTCGCCACTTGGTCATAATCATTTAGATGGTGGTGTAGGGCAAAGCTGTTAGAAAGATTGTAGCGTTTTACTCTCCCTGGGCTTTCCTCCGCCTTGCTGCAACAGAGAGGAAATGCCCATGTCCACAGCTTGTACACACTGCCCCCTCACTATCTTGTTATCCAGTGGCATGCCAAAGGAGAACTGAATTAGCTTCTGAGGCTTCTGCTGTAAATCAGAAGTGTATGTTAGTCAAGAGTAAACAAGATGCACCCAGTATGGTGGGAGGGTTTTGCTGTCAGTAGCTCAAAGTATGGTGTAGAAATGGCCTCCTCCCTCCATCCTGGGAAGTCCCAGTCCCATCCTGGTGTGAGAATCAACCAGGCTTTCCTGCTCCACCTGAGATAACCAACTCCCTCCCGTAATCAGGAAGCCAAATGTCACCTTCCCAAAGAAATTTTATTTTCACGTAGCTGAAGTGCAAAACATAGATGACCATTTTTAATAAGCACAATCAAATTTTTAACCACAGAATGTCTACAAGAATTATAGCTTTAAAAA