Transcript asmbl_8638

Sequence
Transcript Sequence for observation asmbl_8638 of TGE0041829:
CACAGTCCACAAAGGCTTTTTATTTATGCTTTACATTTAAAAAAAGAATCCCAGGATTTTCCCTCCTGTATGTTTTCGTCTTGCCTCTTCATGGTCCATAATGCCAGCCGAGGTTGTCAGCACAATGAGGCCAAACTGACGTGAAGGGAGCAGGTTGTTCTGCCATTTCTCTAGGTCTTTGAGTTGAACATCAAATCTAGGGCTTATAACGCCACACTTGTTCAACCTTCCTGTGAGGTTCACAACAATCTTCCCAGCTCTGTGACCATCAATGATCTCGAATTCACCAATGTATCCGTGCTTCATCATCACAGTTAAGAACCGAACGATGACTTTAGAACATGGCCTGATGAGGACCTGGCGTTTGCCTCTCTTCTCAGCGTTGTTGATGCTCTTGAGAGCATCCGCCAGAACATTCATTCACACCATGGTGGCGGCGAAGGAAGATGGCAGAAAG