Transcript asmbl_56820

Sequence
Transcript Sequence for observation asmbl_56820 of TGE0003118:
CGCGCAGCCTCCGACCCTAATTTCTTCGTTCGCCGGAAGAAGGCGAGTCTCTTTCCGTTCCTAGCGCAGCCATGGCTCGTGGTCCCAAGAAACACCTGAAGCGTGTAGCTGCTCCAAAACATTGGATGCTGGATAAGTTGACTGGCGTGTTTGCTCCTCGTCCATCCACTGGTCCTCACAAGCTGAGGGAATGCCTGCCTCTCATCATTTTCCTAAGGAACAGACTTAAGTATGCCCTGACTGGAGATGAAGTAAAAAAGATTTGCATGCAGCGATTCATTAAGATTGATGGGAAAGTCAGGACCGATATAACCTACCCTGCTGGGTTTATGGATGTCATCAGCATTGACAAGACCGGAGAGAACTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCATCGTATTACACCGGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTAGGCACAAAAGGAATCCCGCACCTGGTGACCCATGATGCTCGTACTATTCGGTACCCTGATCCCCTCATCAAGGTGAACGACACCATTCAGATTGATTTGGAGACAGGCAAAATAACTGACTTCATCAAGTTTGACACTGGGAACCTGTGTATGGTGACTGGAGGTGCTAACTTGGGAAGAATTGGTGTAATCACCAACAGAGAGAGACATCCCGGCTCTTTTGATGTGGTTCATGTGAAAGATGCCAATGGCAACAGCTTTGCCACTCGGCTGTCCAACATTTTTGTTATTGGCAAGGGTAACAAACCATGGATCTCTCTTCCCAGAGGAAAAGGAATCCGCCTCACCATTGCTGAAGAGAGAGACAAGAGGCTTGCGGCCAAACAGAGCAGTGGGTGAAATGGTCTCTAGGAGACATGCTGGAAAAGTGTTTGTACAAGCCTTTCTAGGCAACATACATGCTAGATTAAACAGCATGGTGAAACTA