Transcript asmbl_56497

Sequence
Transcript Sequence for observation asmbl_56497 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGCGACGACTTACTCCCGGCAGGGACTGAGGACTACATTCATATAAGGATCCAGCAGCGCAACGGCAGGAAGACGCTGACCACTGTGCAGGGCATTGCGGACGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGCAATGGAACTGTGATTGAACACCCTGAGTACGGAGAGGTTATTCAGCTTCAAGGGGACCAAAGGAAGAACATCTGCCAGTTTCTTCTGGAGGTTGGCATCGTCAAGGAGGAGCAGCTGAAGGTTCACGGGTTCTAAGATGAACCCAAGCGTGGCGAGTTTCTTAAATGGTTTTGTTCTCTAACTCAGTTTGGCTGCCTCGGGAGATGATTCTTTACAGTAAACGACAGACTTTGCGTTTATTTAATCATTCAGACTTCCACTCACACCTGCATGGCTACAGAAAACACGGGGTATGTAGGCTCCTGAGTCATAAGGAAATCGCGGTGAGATGGGAACGAAGCCCGAGTCCGTCCTAACATGTTTCCAATGGAAAAGGTTTTGTTGTGAGTGTTTGTTGTTAGTTTTATTTTCACTTGACTGTTAAATGTTTTTGTTGTTGTATTAAACCATGTATGTTGCGGCTTAACAATAAAAAGAAAGTGTGC