Transcript asmbl_15509

Sequence
Transcript Sequence for observation asmbl_15509 of TGE0003804:
GTTGCGTTGCCGCTTTCAGGCATCCGTTTAGGACAGCCCCATGGGGCCTGAAGGGGCTTCGTATGGCAACCGGTACAGTTGAGAGTTCAACGGCGCGTTGCAAAGATGCCGCCCAAAGGAAAAAGCGGTTCTGGAAAAGGGGGAAAAGGGGGAGCAGCTTCTGGGAGTGACACTTCTGACAAGAAGTCTCAGGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTGTGCGAAAAACACGGGAAAATCATGGAAGCCATGGAAAAGCTGAAGTCTGGAATGAGATTCAATGAAGTGGCCGCACAGTACAGTGAAGATAAAGCCAGGCAGGGGGGCGACCTGGGCTGGATGACCAGAGGGTCCATGGTGGGGCCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGCTGGACAAGCCTGTGTTTACAGACCCTCCGGTTAAGACAAAATTTGGATATCATATTATTATGGTTGAAGGGAGAAAATAAAACTATCGCAAGACCGAA