Transcript asmbl_15437

Sequence
Transcript Sequence for observation asmbl_15437 of TGE0003793:
CCTGCGGTGCTTCACAGTCTGGCTCCGGCGCCGCCCGTCGCGGTCTCGGTTCTGCTCAGCCCGCCTCTGCTCCTGCTCGGCGTCCGGGCTCCCTGTCCGCAGCCATGAACGCTCTCCTCCCGAGTCGAGCCCGCTGTCTTCTAGATTAGTCCCCGCTGCCGTCCCTGGACCGCCTGCACCATGGAGTCGCCCGCCTCGAGCCAGCCTGCCAGCATACCCCAGTCCAAAGGAAAATCTAAGAGGAAGAAGGATTTACGAATATCCTGTGTGTCCAAGCCACCTGTGCCCAACCCTACGCCACCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGATAGGAACTTTGAGGTGGAGGCTGATGACCTGGTGACCATCTCGGAACTGGGACGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCATGCCCAGAGCGGCACCATCATGGCTGTAAAGCGGATCCGGGCCACTGTCAACACACAGGAGCAGAAGCGTCTGCTCATGGACTTGGACGTCAACATGCGTACAGTCGACTGCTTCTATACTGTCACCTTCTATGGAGCCCTCTTCAGAGAGGGAGATGTATGGATCTGCATGGAGCTCATGGACACATCCTTGGATAAGTTCTACCGGAAGGTGCTTGATAAAAACATGACGATTCCAGAGGACATTCTTGGGGAGATTGCTGTGTCTATTGTGAGGGCACTGGAGCATCTGCACAGCAAGCTGTCCGTGATCCACAGAGATGTGAAGCCATCTAATGTCCTCATCAACAAGGAGGGCCATGTGAAGATGTGCGATTTTGGGATCAGCGGCTACTTGGTGGATTCTGTGGCCAAGACGATGGATGCTGGCTGCAAGCCCTATATGGCTCCTGAGAGAATCAACCCGGAGCTGAACCAGAAGGGCTACAACGTCAAGTCTGATGTCTGGAGCCTCGGAATCACCATGATCGAGATGGCCATTCTACGGTTTCCTTATGAGTCTTGGGGGACCCCGTTCCAGCAACTGAAGCAAGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCTGACCGTTTTTCCCCTGAGTTTGTGGACTTCACCGCACAGTGCCTAAGAAAGAACCCCGTGGAGCGCATGAGCTACCTGGAGCTGATGGAACATCCTTTCTTCACCTTGCACAAAACCAAGAAGACAGACATCACTGCTTTTGTGAAGGAAATCCTGGGAGAGGACTCATAGGGGGCAGGGCCTCGGACCCCACTCTGGCCCTCTAGTGCCCCACAGCCCCCTCTGCTGGAGCAGTGCTTGCCCACACCTATAAGCTACTGCCACCCTGGCCTTGGGCATTCCAAGAGGAATCGAGGGGGCTGCTCCCAAGTGCCAAAGAACCAGACTGTCGGGGCCCCCCGCTGGGCCCATGCGGGCCCCACCAGTGCCTCTGTCCTGCTGTTCCAAGTCTCCAGCCCTGAGGCCTTGGACTTGGAGGGGCCTGGATGCCCCTGCCAGACGCTGCTGCCCCTCACAGAAGGCATCCGGTGCTTGTGCACAGGCCACTGCCTTGGCCCAGCCCTGGATGCCACCTGAGTTGTATATTTTTGTATCTTTCGACTGAATGAACTTTGCACACTTCAAGGGTGGCCACACATCTCTCCCAGCATCAGTAGAGGGGACATGGGGATGAGCCACATGAGTCCTCCTGATCCCCCTCTGAGGGAGAAGCCAGAGCCACTTGAGGCCTTCACCCAGCACTGGCAAATGGCCTCTAAGGGGCACCAAGGACACTTAGCCTCTGCCTGCCACCTCTAGGGGTGTTGTTTCACTTTTTAAAAACAAATTTGTCTTTTTTTTTCTTTTGCTTTGTGGGTTTGGCTGGTTTTTCTCGCATGGTTTGGAGCCGATAACTTTTCTGCCACTCCCTAGGGGACCAGCAAGCTGAGACCCACCCTCTCCACTCAGGCTGGAGTCTAGGAGGATGAGCCCAAAGTCTCTGCTTAGAGAGGTATTCTTCTTGGGGATTGGCTTGACAGGGGCTATAGATTTGCTTTTGGTGTTAGAAAAGAAAAAAATGTTTTGAAGGACTACCTGTTCTGGGTTCTATCCCTGGTGGATTGGGGCAGTTACATGATTGCTGTTTTGATTTAAAA