Transcript asmbl_47433

Sequence
Transcript Sequence for observation asmbl_47433 of TGE0001056:
AAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTT