Transcript asmbl_14836

Sequence
Transcript Sequence for observation asmbl_14836 of TGE0008162:
GCGGCAGACGCGGTGCTCGGTCATGGGGTTCCAGCCGAGCCCAGGCCTCCTGGCCTCCCTGGGGGTGGGGCTGCTGACTCTGCTCGGCCTGGCTCTGGGCTCCTACTTGGTTCGGAGGTCCCGCCGGCCGCGGGTCACTCTTCTGGACCCCAATGAGAAGTACCTGCTGCGACTGCTGGACAAGACGACTCTGAGCCACAACACCACGAGGTTCCGCTTTGCCCTGCCCACCGCCCACCACGTTCTGGGGCTGCCTGTGGGGAGACACGTCTATCTCTCTGCCCGAATCGATGGCAGCCTGGTCATCAGGCCATACACTCCCGTCACCAGTGATGAGGACCAAGGCTACGTGGATCTCGTCGTCAAGGTGTATCTGAAGGGCGTGCACCCCAAATTTCCTGAGGGAGGGAAGATGTCTCAGTACCTGAACAGCCTGAAGATTGGGGATGTGGTGGAGTTTCGAGGCCCGAACGGGTTGCTCACTTACCTCGGGAAAGGGATTTTTAGCATTCAGCCCGACAAAAAGTCTCCAGCGGAGCCCCGTGTGGCCAAGAGCCTAGGGATGATTGCCGGTGGGACAGGAATCACCCCGATGCTTCAGCTGCTCCGGGCCATCCTGAAAGACCCTGAAGACCGAACTCAGTGCTGTTTGCTTTTCGCCAACCAGACTGAAAAGGACATCATCTTGCGTGAGGACCTGGAGGAGCTGCAGGCCCAACACCCCGGTCGCTTCAAGCTCTGGTTCACTCTGGATCACCCTCCAGAAGGTTGGGCCTACAGCAAGGGCTTTGTGACTGCCGACATGATCCGGGAGCACCTGCCCGCCCCAGCAGATGACGTGCTGCTGCTGCTCTGCGGGCCTCCCCCCATGGTGCAGCTGGCTTGCCACCCCAACTTGGATAGGTTGGGCTACTCACAAAAGATGCGATTCACGTACTGAGTGTCTCGTAGCTTCCCTGGTCTGTTCCGGCCACTGTCCCCAATCAGCACTCACACTCTGCGAGCCCTAGATTTCCTTCCTGACACGGTCAGCTTGTTTTCTTTCTCCGGAGCTGAAACGGGACGGTACGTGCTGGAATAGCAACCTTGTAGCCCTGGACGAGGGCCAGGGCTGAGCCGTTCCTGGAAGGCCCCAAATCTCCCTGTGATAAAAGATTCGTGTTAGACCGTGGGTCAGAAAGAAGCATTACATTTGTTCCAGGACTGGCTAGTTCCTTGATAGCGTCACACTGTTCTTTGTGTCTGTGATGAGAAGAACAGTCAGTGTAATGGGTTTTATTTAACCTCCGGTGCTTAAACTCATAGCAGATTCTGTGTGTGAGTGCCAGATGAGGAGACTTTTAGAGTTAGTCTTGCAGAGATTGCAGGAAAGGAGGAAACGGTTTCTTCAGACCTGCAGACCTCAGAGAAAGGAATCTGAAATACATGTTTGTGTGTCTGTCTCTCTCCACCCCTCCCCAGGCTGGAGGGGAGTGGCTATCCACAGTCTAAGACTGCTGCTTGTGGCAGGAACTTCTGGCTGTGCGAATAAAGGGGGCCGAGGCCCCAGTGTTATCTTTAAA