Transcript asmbl_25470

Sequence
Transcript Sequence for observation asmbl_25470 of TGE0000843:
GGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAA