Transcript asmbl_47045

Sequence
Transcript Sequence for observation asmbl_47045 of TGE0009200:
CCCTCTCAGGACTGTGTGCTGTGCTCATGAGAAGTGACCACGGGGACCATCTAGGCTGAAAATGGCCCAGCCTGCTTGGAAGGGCTTAACTGGGGGTAGGGGTGAGAACTTGGACTCTGTCCAGTTGGCAACAAGGAGCCATGAGCAGGGGTTGAGTGGTAGAAGTCAGTGCTTTTGACCAAAATCATGGGGACAGTGCATACTTCTGTCCCACGGAGGTTCAAGGACTACCTCATGTCCTCCCTCCCTCCAAAAAAGGTCAGGAATTGGGCTGGGCTGGCCTGGCTGTGGTGACCCTGGTCTTCTCCTGTCTCCAGAGAAATCTTGGTAGAAGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTATGCGGTGACATCCATGGACAATTCTATGACCTCAAGGAGCTGTTCAGAGTAGGTGGCGATGTCCCTGAGACCAACTACCTCTTCATGGGAGACTTTGTGGACCGTGGTTTCTACAGTGTTGAAACCTTCCTCCTCCTGCTGGCTCTTAAGGTTCGCTATCCTGACAGAATCACTTTGATCCGGGGCAATCATGAGAGTCGCCAGATTACCCAGGTCTATGGGTTCTATGATGAGTGCTTACGGAAATATGGTTCAGTGACTGTATGGCGCTACTGTACTGAGATCTTTGACTACCTCAGCCTGTCTGCCATCATTGATGGCAAGATCTTCTGTGTGCATGGAGGTCTTTCCCCTTCCATCCAGACCTTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTACCCCATGATGGACCCATGTGCGACCTCCTGTGGTCTGACCCTGAAGACACAACAGGCTGGGGAGTGAGCCCCCGCGGGGCAGGTTACCTGTTTGGCAGTGACGTGGTCGCCCAGTTCAATGCAGCCAACGACATTGATATGATCTGCCGTGCCCACCAATTAGTGATGGAAGGCTACAAGTGGCACTTCAATGAGACCGTGCTTACTGTGTGGTCAGCGCCTAATTACTGCTACCGCTGTGGCAATGTGGCAGCCATCTTAGAACTGGATGAGCACCTCCAGAAAGATTTCATCATCTTCGAGGCTGCACCCCAAGAGACACGTGGCATCCCCTCCAAAAAGCCAGTGGCCGACTATTTCCTGTGACTCCTTGGCCCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTGCCCAGTCGGAGGCTGGGTCTGAGGGGCTGCCTGGCTTTGCTTGCCCCAGGGTGCGGACTTGCTCTGGAGAGGTGGAGCCTTGGCTCCTGGCTTCCTCTCCTTTCTCCCACTTGATCCATGAAGTTTTCAGTCATTTTTT