Transcript asmbl_25459

Sequence
Transcript Sequence for observation asmbl_25459 of TGE0000842:
CGCGCGGCCGCCATCTTTCCGTCCCGGGCAGCCAGCGCCAGTCGGAGCCAGCGCGAGCCGCCGCCGCCATCACTGCCGCTGCCAAGTCCTCCACCCGCTGCCCCCGCCATGTCTGCTACCGCTGCCACGGCCCCCCCTGCTGCCCCGGCTGGGGAGGGTGGTCCCCCTGCACCCCCTCCAAACCTCACCAGTAACAGGAGACTGCAGCAGACCCAGGCCCAGGTGGATGAGGTGGTGGACATCATGAGGGTGAACGTGGACAAGGTCCTGGAGCGAGACCAGAAGCTGTCGGAGCTGGACGACCGTGCAGATGCACTCCAGGCGGGGGCCTCCCAGTTTGAAACAAGCGCAGCCAAGCTCAAGCGCAAATACTGGTGGAAAAACCTCAAGATGATGATCATCTTGGGAGTGATTTGCGCCATCATCCTCATCATCATCATAGTTTACTTCAGCACTTAAATCCCCGAGGAGTCTGCCCTGCCTAGAGAAGGGCCTCTCCCCCAACCCTCAGCCGTTCCTCCACCTCTCAGCCATATCTTTCAGCCCCCACTCCCCTGGATCCGTGTGTGTGTGTGTCCGTGTGTGTGT