Transcript asmbl_25440

Sequence
Transcript Sequence for observation asmbl_25440 of TGE0000841:
GCAGGGGGAGGTGGAGGCTGTGGAGCGGCAGCGGCAGCAGCGGGTCCCGGGACTGAGGCAGCAGCGGGGGCGGCGGCGGGCGGAAGCTGAGGTGACGAAGGCAGCGGCGGCGGCGGCCGTTTCCCTCACGGTGGCGGAGACCAAGGCGGCGGCGGCGGACGGGGAGCGGCCCGGCCCCGGCCCCCTGCTCGTTGGCTGTGGCAGGGCCGCCGTGGGGCCGGCCCGGCTCCCGCCCCCCGCGGCTCCCCCTCCGGCTCCTCCTCCGGGGAGACGCCGGGGGCCTGGCCCGGCCCGCACTCAGACTGCTGCTGCAGCCGCCGCCGGGGGAGTCGGAGGCGGTGGCGGCGCCATGGGCGGCCTGGCCTCTGGGGGGGATGTGGAGCCGGGACTGCCCGTCGAGGTGCGCGGCTCCAACGGGGCCTTCTACAAGGGCTTTGTGAAGGATGTCCATGAAGACTCTGTCACCATCTTCTTTGAAAACAACTGGCAGAGTGAGAGACAAATTCCTTTTGGGGATGTCCGGCTACCACCTCCAGCTGACTATAATAAGGAGATCACAGAAGGGGATGAAGTGGAGGTTTATTCTCGAGCCAATGAACAGGAACCTTGTGGCTGGTGGCTGGCCCGGGTGCGGATGATGAAGGGAGATTTCTATGTCATTGAATATGCTGCCTGTGATGCCACCTACAATGAAATTGTTACCCTGGAGCGACTTCGGCCAGTTAATCCCAATCCCCTTGCAACCAAAGGCAGCTTCTTCAAGGTTACCATGGCTGTGCCCGAGGATCTGAGAGAAGCCTGCTCCAATGAAAACGTCCATAAAGAGTTCAAGAAAGCCCTGGGAGCCAACTGCATCTTTCTCAACATCACAAACAGTGAGCTCTTCATTCTGTCAACCACAGAAGCCCCTGTGAAGCGAGCATCTCTGCTGGGTGATATGCATTTCCGAAGCCTGCGCACCAAACTGCTACTTATGTCCCGCAATGAAGAAGCTACCAAGCACCTAGAGACAAGCAAGCAGTTGGCAGCAGCCTTCCAAGAGGAGTTCACAGTGCGAGAGGACCTGATGGGACTGGCAATTGGGACTCACGGTGCCAACATCCAGCAGGCCCGAAAAGTACCTGGGGTGACCGCCATTGAGTTGGGTGAAGAGACCTGCACTTTCCGCATCTATGGGGAGACTCCCGAGGCTTGCCGACAGGCCCGAAGCTACCTTGAGTTTTCTGAGGACTCAGTGCAAGTGCCCAGGAACCTGGTTGGCAAAGTGATTGGAAAGAACGGGAAAGTGATCCAGGAGATTGTGGATAAATCTGGTGTGGTGAGGGTTCGAGTGGAAGGTGATAATGACAAGAAGAACCCCAGGGAGGAGGGAATGGTTCCCTTCATTTTTGTTGGCACCCGAGAGAACATCAGCAATGCCCAGGCTTTGCTGGAGTATCACCTCTCCTACCTGCAGGAGGTAGAGCAGCTTCGCTTGGAGAGGCTACAAATTGATGAGCAGCTTCGGCAGATTGGGCTGGGCTTTCGCCCTCCTGGGAGTGGGCGGGGCAGCGGTGGCAGCGACAAGGCTGGATATAGCACTGATGAGAGCTCCTCCTCCTCCCTCCATGCGACTCGAACCTATGGGGGCAGCTATGGGGGCCGTGGCCGTGGCCGGAGGACAGGCGGTCCTGCCTATGGCCCCAGCTCAGATGTGTCTACAGCTTCAGAGACTGAGTCAGAGAAGAGAGAGGAGCCCAACCGAGCTGGGCCTGGCGACAGGGATCCCCCAACCCGAGGGGAAGAAAGCCGGAGGCGGCCGACTGGGGGCCGGGGTAGGGGACCCCCACCTGCCCCCCGGCCCACTTCGAGATACAATTCTTCATCTATTAGCTCAGTGCTGAAGGATCCAGACAGTAATCCCTACAGCCTATTGGACACGTCTGAACCAGAGCCCCCGGTTGATTCAGAACCTGGGGAACCCCCCCCAGCAAGTGCCAGGCGCCGCCGCTCCCGCCGCCGCCGCACTGATGAAGACAGGACCGTCATGGATGGAGGCCTGGAATCAGATGGGCCCAACATGACAGAGAATGGCCTGGAAGATGAATCAAGACCTCAACGTCGTAATCGCAGCCGCCGCCGCCGTAACCGTGGTAATCGGACTGATGGCTCTATCAGTGGAGACCGCCAGCCAGTGACTGTGGCTGACTATATCTCACGAGCAGAGTCTCAGAGCCGCCAGAGGCCACCCCTGGAACGCACTAAACCCTCAGAAGACTCTCTTTCAGGACAGAAGGGTGACTCTGTCAGCAAGCTTCCTAAGGGCCCCTCGGAGAATGGGGAGCTCTCCGCCCCCTTGGAGTTGGGTAGTATGGTGAATGGGGTTTCATAAAACCTCCAACCTGCACCCCTCCCTTCTCCATCTCGCTTGCTGCCCAACACCATGGCCCTCACAGGCCCAACTGACCTGCGCTGGAGCTGCTCTTATCTAGGGGGGAGGGGGGTGGCACAGCAGCTTGGGTACCCCCCAACCTCCAGGAGCTAGTGGAGGGGTGTGTAACAGGGTCATACCCCCTCCCTCTTGTCCACCCTACCCCCAGGGTAAGGGGAGCCTCTCTCCTTCCCCATCAGACTGGATGTGCCTTTATCCTCTAATGCCCCAATCTCTCTCTGAACACCCCCATTCTCCACCTGTTGGTGGGGGGTGCTCCTCGACCCACCCAGATTTGACCGTTCAGGGGGCCTCCCCTGCTATCCCTCCTCCCATCCTGTACCCCCCATTTCTGGGGCCTCATCACTGTGGAAGACGGGGATAGTAAGAGATAAGTGGGTGGGAGGCACGGGGAAGGTTTTGGAGTAGAACCAGGGGTGTGTATGAAGGGGGGTGACAAGGTCCCCCTGGGGAGGGGACCAACCTTGTCTGGTGGATGAGAAGGCGTATTTATTTTTCACTGTACAGTATTTAAAAAGAGAATAAAAAAATCCAAATGGC