Transcript asmbl_44621

Sequence
Transcript Sequence for observation asmbl_44621 of TGE0055258:
CGGAGCCATTTTCCCCCCTTCGGCCGCGGCGAGGAGGAGCTGGAGCGGGAGTGACACCGGCGAGACCCAGCGCGACCTGAGGCGGCTCTAGGTGACTCGGGCCAGTGCAGAGGGCCCCAGGCCGCAGGCAGGAGCAGCTGGGCCAATTCCCTGGCCGGGGAACGGAAGGGGATGGCGTCGGGCCTGGGCTCCCCGTCCCCCTGCTCAGCGGGCAGTGAGGAGGAGGATATGGACGCACTTCTGAACAACAGCCTGCCCCCACCCCATCCAGAAAATGAGGAAGACCCAGACGAGGATTTATCCGAAGCAGAGACTCCAAAGCTCAAGAAGAAGAAAAAGCCTAAGAAACCTCGAGACCCTAAAATCCCTAAGAGCAAGCGCCAAAAAAAGGAGCGTTTACTCTTATGCCGGCAGCTGGGGGACAGCTCTGGGGAGGGGCCAGAGTTTGTGGAGGAGGAGGAAGAGGTGGCTCTGCGCTCAGACAGTGAGGGCAGCGACTATACTCCTGGCAAGAAGAAGAAAAAGAAGCTCGGACCTAAGAAAGAGAAGAAGAGCAAATCCAAGCGGAAGGAGGAGGAGGAAGAGGAGGACGAGGATGATGACTCGAAGGAACCTAAGTCATCAGCCCAGCTTTTAGAAGACTGGGGTATGGAAGACATCGACCATGTGTTCTCAGAGGAGGATTATCGGACCCTCACCAACTACAAGGCCTTCAGCCAATTTGTTAGACCCCTGATTGCTGCTAAAAACCCCAAGATTGCTGTCTCCAAGATGATGATGGTCTTGGGTGCAAAGTGGAGGGAATTCAGTACCAACAACCCCTTCAAGGGCAGCTCCGGAGCATCAGTGGCAGCTGCGGCGGCGGCGGCTGTGGCTGTGGTTGAGAGCATGGTGACAGCTACTGAAGTCGCCCCTCCCCCTCCCCCTGTGGAGGTGCCGATCCGCAAGGCCAAGACCAAGGAGGGCAAAGGTCCCAATGCTCGGAGGAAGCCGAAAGGCAGCCCGCGAGTGCCTGACGCCAAGAAGCCCAAACCCAAGAAAGTAGCTCCTCTGAAGATCAAGCTGGGAGGGTTCGGCTCCAAGCGGAAGAGATCCTCGAGTGAGGACGACGATTTAGATGTAGAGTCTGACTTCGACGATGCCAGTATCAACAGCTATTCTGTTTCGGATGGTTCCACCAGCCGCAGTAGTCGGAGCCGTAAGAAACTCCGGACCGCTAAAAAGAAAAAGAAAGACCACCAGGACTATTGCGAGGTGTGCCAGCAAGGCGGCGAGATCATCCTGTGTGATACCTGTCCCCGAGCCTACCATATGGTGTGCCTGGACCCAGACATGGAGAAGGCCCCGGAGGGCAAGTGGAGCTGTCCGCACTGTGAGAAGGAGGGGATCCAGTGGGAAGCTAAGGAGGACAATTCTGAGGGTGAGGAGATTCTGGAAGAAGTCGGGGGGGACCCAGAAGAGGAGGATGACCATCACATGGAATTCTGTCGCGTCTGCAAGGACGGCGGGGAGCTCCTGTGCTGTGACACATGCCCTTCTTCCTACCACATCCACTGCCTGAACCCCCCGCTGCCAGAGATCCCAAACGGCGAATGGCTCTGTCCCCGCTGTACTTGTCCAGCTCTTAAGGGCAAAGTGCAGAAGATCCTAATTTGGAAGTGGGGCCAGCCACCGTCTCCCACACCAGTGCCTCGGCCTCCAGATGCTGACCCTAATACCCCGTCGCCCAAGCCCTTGGAGGGGCGGCCAGAGAGGCAGTTCTTTGTGAAATGGCAAGGCATGTCTTACTGGCACTGCTCCTGGGTGTCAGAACTGCAGTTGGAGCTGCACTGTCAGGTGATGTTCAGAAACTACCAGCGGAAGAATGATATGGACGAGCCGCCTTCTGGGGACTTTGGTGGAGATGAAGAGAAGAGCCGGAAGCGAAAGAACAAGGACCCTAAGTTTGCAGAGATGGAAGAGCGCTTCTACCGCTATGGAATAAAACCGGAGTGGATGATGATCCACCGCATCCTCAACCACAGTGTGGACAAGAAGGGCCACGTTCACTATTTAATCAAGTGGCGAGACCTGCCCTATGACCAGGCGTCCTGGGAGAGCGAGGACGTGGAGATTCAGGACTACGACCTGTTCAAGCAGAGCTACTGGAACCACAGGGAGTTAATGAGGGGTGAAGAAGGACGACCCGGCAAGAAGCTTAAGAAGGTGAAGCTACGGAAACTGGAAAGGCCTCCGGAGACCCCAACTGTTGATCCCACCGTGAAGTATGAGCGACAGCCGGAGTATCTGGATGCGACGGGTGGAACCCTGCATCCCTACCAAATGGAAGGCTTAAACTGGCTCCGCTTCTCCTGGGCTCAGGGAACCGATACTATCTTGGCTGATGAGATGGGCCTTGGGAAAACTGTGCAGACAGCAGTCTTCCTCTACTCCCTCTATAAGGAGGGTCACTCCAAAGGCCCCTTCTTAGTGAGCGCTCCTCTGTCCACCATCATCAACTGGGAGAGAGAGTTTGAGATGTGGGCTCCTGATATGTATGTGGTAACCTATGTGGGTGACAAGGACAGCCGTGCCATCATCCGGGAAAATGAGTTCTCCTTTGAAGACAATGCCATTCGTGGTGGCAAGAAGGCCTCGAGGATGAAGAAAGAAGCATCGGTGAAATTCCATGTTCTGCTGACATCCTATGAGTTGATCACCATTGATATGGCCATCTTGGGTTCTATTGACTGGGCCTGCCTCATTGTGGATGAAGCCCATCGGCTGAAGAACAACCAGTCTAAGTTCTTTCGAGTTTTGAATGGTTACTCACTCCAGCACAAGCTGTTGCTAACTGGAACTCCGTTACAGAACAATCTAGAGGAACTGTTTCATCTGCTCAACTTTCTCACCCCTGAGAGGTTCCACAACTTAGAAGGCTTCTTGGAGGAGTTTGCAGACATTGCCAAAGAGGACCAGATTAAAAAACTCCACGACATGCTGGGGCCTCATATGTTGCGGCGGCTCAAAGCTGACGTCTTCAAGAATATGCCATCCAAGACAGAGCTGATTGTGCGCGTGGAGTTGAGTCCTATGCAGAAGAAGTACTACAAGTATATTCTCACGCGGAATTTCGAAGCACTTAATGCTCGAGGTGGTGGCAACCAGGTTTCTCTGCTGAACGTGGTGATGGATCTTAAGAAATGCTGCAACCACCCTTATCTCTTCCCTGTGGCAGCAATGGAAGCCCCTAAGATGCCTAATGGTATGTATGATGGCAGTGCCCTAATCAGAGCATCTGGGAAGTTGTTGCTGCTGCAGAAGATGCTTAAGAACCTGAAAGAGGGAGGGCATCGTGTGCTCATCTTCTCCCAGATGACCAAGATGTTGGACTTGCTAGAGGATTTTTTAGAACATGAAGGTTATAAATATGAACGTATTGATGGTGGAATCACTGGGAACATGCGTCAGGAGGCCATTGATCGCTTCAATGCACCGGGTGCTCAACAGTTCTGCTTCTTGCTTTCCACTCGAGCTGGGGGCCTTGGGATCAATCTGGCCACTGCGGACACAGTTATTATATATGACTCTGACTGGAACCCCCATAATGACATCCAGGCCTTTAGCAGAGCCCACCGTATTGGGCAAAATAAGAAGGTGATGATCTACCGGTTTGTGACCCGTGCATCAGTGGAGGAGCGCATCACGCAGGTGGCAAAGAAGAAGATGATGCTGACACATTTAGTGGTACGGCCTGGCCTGGGCTCCAAGACAGGCTCAATGTCTAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAGCTATTCAAGGATGAAGCCACGGATGGAGGAGGAGACAACAAGGAGGGAGAAGACAGCAGTGTTATCCACTATGACGATAAGGCCATTGAACGACTGCTGGATCGAAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCTCAGTATGTGGTACGGGAAGAAGAGATGGGGGAAGAGGAGGTAGAACGGGAAATCATAAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCGAAATCTGGGCAAAGGAAAAAGAATCCGTAAACAGGTCAACTACAATGATGGCTCACAGGAGGACCGAGATTGGCAGGACGACCAGTCCGACAACCAGTCCGATTACTCAGTGGCCTCAGAGGAAGGTGATGAAGACTTTGACGAACGGTCAGAAGCTCCCCGCAGGCCCAGTCGCAAGGGCCTGCGGAATGATAAAGATAAGCCATTACCTCCTCTGTTGGCCCGTGTTGGTGGGAATATTGAAGTACTTGGTTTTAATGCTCGTCAGCGAAAAGCATTTCTTAATGCAATTATGCGATATGGCATGCCACCTCAGGATGCTTTTACCACTCAGTGGCTTGTGAGAGATCTTCGAGGCAAGTCAGAGAAAGAATTTAAGGCTTATGTGTCACTCTTCATGCGACATTTGTGTGAGCCTGGGGCAGATGGGGCTGAGACCTTTGCTGATGGCGTCCCACGAGAAGGCCTGTCTCGTCAACATGTTCTCACTAGGATCGGTGTCATGTCTCTGATTCGAAAGAAGGTTCAGGAGTTTGAACATGTTAATGGACGCTGGAGCATGCCCGAACTGGCTGAAGTAGAGGAAAACAAAAAAATGTCTCAGCCAGGTTCACCTTCTCCAAAGACTCCTACACCTTCCACACCAGGGGACACACAACCCAATACTCCTGCGCCTGTGCCACCTGCTGAGGATGGGATAAAAATAGAGGAAAATAGCCTTAAAGAAGAAGAGAGCACAGAAGGAGAGAAGGAAGTTAAATCTACAGCCCCTGAGGCGACTGTGGAGTGTGCACAGCCCCCTGCCCCTGCCCCTGCCACTGCCCCTGCCACTGCCACTGCCCCTGAGGATGACAAGGCTCCTGCTGAGCCTCCTGAGGGGGAGGAAAAAGTGGAAAAGGCAGAGGTGAAGGAGAGAACAGAGGAGCCTATGGAGACAGAGGCCAAAGGTACTACTGAGGTGGAGAAAGTGGAGGAGAAGTCTGCGGTAGACCTGACCCCGATCGTGGTGGAAGACAAAGAAGAGAAGAAGGAGGAGGAGGAGAAAAAGGACGTGATGCTTCAGAATGGAGAAACTCCCAAGGATCTTAGTGATGAGAAGCAGAAGAAAAACAGCAAACAGCGTTTCATGTTCAACATTGCAGATGGTGGTTTTACTGAGTTGCACTCACTGTGGCAGAATGAAGAGCGGGCAGCCACAGTCACTAAGAAGACTTACGAGATCTGGCACCGTCGCCATGATTACTGGCTGCTGGCTGGCATTATAAACCACGGCTATGCCCGGTGGCAGGACATCCAGAATGACCCACGGTATGCCATCCTCAATGAGCCTTTCAAGGGTGAAATGAATCGTGGCAATTTTCTAGAGATCAAGAATAAATTTTTAGCTCGAAGATTCAAGCTCTTAGAACAAGCCCTGGTGATCGAGGAGCAGCTTCGCAGGGCAGCTTACCTGAACATGTCCGAGGACCCCTCTCACCCGTCTATGGCCCTTAACACCCGCTTCGCTGAGGTGGAGTGTTTGGCAGAAAGTCACCAGCACCTGTCCAAGGAGTCGATGGCAGGGAATAAGCCGGCCAATGCAGTCCTACACAAAGGTCTCCTGAAACAGCTGGAGGAACTGTTGAGTGACATGAAAGCTGATGTGACGCGGCTCCCAGCCACCATTGCCCGCATCCCCCCAGTCGCTGTGAGGTTACAGATGTCAGAGCGGAACATTCTCAGCCGCCTGGCAAACAGGGCGCCAGAACCTCCCCCACAGCAGGTAGCCCAGCAGCAGTGAAAGACCCAGAGTGATATCCACCTCCACCACTCAGCAGTGACCTTCCTCACTTTCTCTTGTCCCGGCTGCCCCTGGGGGCCAGAGAGACCCTTGCCTTCCTTCTGCCCATCTTCTGAGTTGTAAAGGAACAGCCCTGCGCAGTGGGGCAGGGAGGGAGGGAGAAGCAATGGTGCCCTTCCTGCTGGAGAGACAAGCAG