Transcript asmbl_14340

Sequence
Transcript Sequence for observation asmbl_14340 of TGE0003736:
GACACGGAACGGCTGTATTCAGTGGTGTTCCAAGAAATCTGTGGGCGCTACGGGAAGACGTACAGCTGGGACGTCAAGTCCCTCGTCATGGGCAAGAAGGCCTTCGAGGCGGCCCAGGTCATCATAGACGTGCTGCAGCTGCCGATGTCCAAAGAGGAGCTGGTGGCAGAGAGCCAGGCCAGGCTCGAAGCGCTGTTCCCCACGGCGGGCCTCCTGCCAGGGGTGGAGAAGCTGATCCACCATCTGCGAAAGCATCGCGTGCCCTTTGCCGTGGCCACCAGCTCCGGGTCCGACACCTTCGTGATGAAGACCAGCGCGCACAAAGCGTTCTTCAGCCTCTTTCATCACGTCGTGCTGGGGGACGACCCCGAAGTGAAGAACGGCAAGCCGGACCCCGACATATTCCTCGCGTGTGCGAGGAGGTTCCTCCCCCCCGCCCCCGTGGACAAGTGCCTTGTCTTTGAAGACGCTCCCAACGGGGTGGAGGCGGCCCTCGCAGCCGGGATGCAGGTGGTCATGGTGCCCGATGCACACCTGCGCCGAGACCTGACGGCCAAGGCCACCGTGGTGCTGGAGTCCCTGCAGGACTTCCGGCCCGAGCTCTTCGGGCTGCCGCCCTACGAGTGAGCGGCGGCCACGCTGCTCCGCCTGCCCCGCACCCGCGTGTCACCATCGCCACGTCGCCCTCGTCCCAGCCTCACCCCTGTGCGCTGGCTCCAAAACGATGATAGGCTGTAGCCCCACGGTCGAGAGGAAACAAGGTAGAGACAGCGGGCAGGGTGCACTGAGCACAGCTGTCCCTTGCACAGTTAGAGTTGCCTACTGTATTAGTCTTAGCATAGTCAGAGTCACACACAGTGAGCACACGTGCACACACATCCATGCTTATGTGTGAACACGCACGCAGATATGTACGCGTGTGTATACATACGTGCATAGATATGTAAAATACAAGGAAAAATGAAATTACGTTTGTGTTCATTTCTTTTTAGTTTTTCTAAACCCTGACTAGAACATGTAAAAAATGCACACATATATTTATATGCTTTAGTCCGTGTGTGTGTGTGTACGTATACATATTTATAATTTATGTTCATTGTAAATATTTACAGTGTACATAAACACTGCAGAAATTGATACTCTTTTTTGCCTTCGAAATACCTCTCGACCATATCACCGGTGGTATTTTTAGTATGAACATAATTTTAGCCTGTATCTCATACCTAGGCACATACCCACATTCAAAAATGGTTTATAGCTCAAAAATTTATCCTCTCTCCTCTGAGAACATTTATTTTTCTAATATGTGCCTTGATGTATATGTAATTTGATTTCCGAATGTGTACTTGGTACAGCCCAGAGCCACAGCACATTTCCAGGATAATTCATCAGATGTTACACTTTGGCCATTAATCCCCTTTAATTGATTTACTCTGCCTTTTGTGAGTGACAGGCATTGAAATGGGACACATACAATCACAGGGGTGTGCCTGCTTCTGTACCCTTGCAGTTGGTCTCTGTCATTAATTGTCATTGAGCTAATTTTCAACTCTCAGTTGTAGAAAAAACATAGTAATGTATGTGATTGTCTGTTGGATGATTGCCTGTGAATGATCGCCTCTGGCTGGTGACCGATTGTACCTCAGTTCAGCAGCAAATTCATTTCACATTCTCGAAGGCCTGTGTACTTGTCTGTTCTTTGAATTCTCCTTCAACTGGCTGTAACATTTCACTGGTTAGCCCGCCAGTTAATTTACTTGAATAAAATTTTTGACAGCTGTTCACATTA