Transcript asmbl_11108

Sequence
Transcript Sequence for observation asmbl_11108 of TGE0000083:
GCCCCACCTCCGCATTCCTTGGTGCCACTGACCACAGCTCTTTCTTCAGGGACAGACATGGCTCAGCGGATGACAACACAGCTGCTGCTCCTTCTAGTGTGGGTGGCTGTAGTAGGGGAGGCTCAGACAAGGATTGCATGGGCCAGGACTGAGCTTCTCAATGTCTGCATGAACGCCAAGCACCACAAGGAAAAGCCAGGCCCCGAGGACAAGTTGCATGAGCAGTGTCGACCCTGGAGGAAGAATGCCTGCTGTTCTACCAACACCAGCCAGGAAGCCCATAAGGATGTTTCCTACCTATATAGATTCAACTGGAACCACTGTGGAGAGATGGCACCTGCCTGCAAACGGCATTTCATCCAGGACACCTGCCTCTACGAGTGCTCCCCCAACTTGGGGCCCTGGATCCAGCAGGTGGATCAGAGCTGGCGCAAAGAGCGGGTACTGAACGTGCCCCTGTGCAAAGAGGACTGTGAGCAATGGTGGGAAGATTGTCGCACCTCCTACACCTGCAAGAGCAACTGGCACAAGGGCTGGAACTGGACTTCAGGGTTTAACAAGTGCGCAGTGGGAGCTGCCTGCCAACCTTTCCATTTCTACTTCCCCACACCCACTGTTCTGTGCAATGAAATCTGGACTCACTCCTACAAGGTCAGCAACTACAGCCGAGGGAGTGGCCGCTGCATCCAGATGTGGTTCGACCCAGCCCAGGGCAACCCCAATGAGGAGGTGGCGAGGTTCTATGCTGCAGCCATGAGTGGGGCTGGGCCCTGGGCAGCCTGGCCTTTCCTGCTTAGCCTGGCCCTAATGCTGCTGTGGCTGCTCAGCTGACCTCCTTTTACCTTCTGATACCTGGAAATCCCTGCCCTGTTCAGCCCCACAGCTCCCAACTATTTGGTTCCTGCTCCATGGTCGGGCCTCTGACAGCCACTTTGAATAAACCAGACACCGCA