Transcript asmbl_43740

Sequence
Transcript Sequence for observation asmbl_43740 of TGE0001880:
GCTCGGGGCGGCGGCGGTGGCGGAAGTGGAAGCAAGGCCGGAGCTTTGACCATAAAGCCCAAGGCGGCGGCGTTGGCGGCGGTGTTTGGGGCCGGGCAGCTCCGAGGAGCCTGCTGGAGCCGGAATCGGACGTCTCTGTTGCGGCCTGCGTTGTGTCTCCTCCTCCGTTGACCCTGCGCTTCAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTCATCATCCTGGGGGACTCTGGTGTTGGAAAGACCTCTCTCATGAACCAGTATGTGAACAAGAAGTTCAGTAACCAGTACAAAGCCACAATAGGAGCGGACTTTCTGACCAAGGAGGTGATGGTGGACGACAGACTTGTTACCATGCAGATCTGGGACACAGCCGGTCAAGAACGGTTCCAGTCTCTTGGTGTGGCCTTCTACAGAGGTGCAGATTGCTGTGTTCTGGTGTTTGATGTGACTGCCCCCAACACTTTCAAAACCCTCGACAGCTGGAGAGACGAGTTTCTCATCCAGGCCAGCCCCCGGGATCCCGAGAACTTCCCTTTTGTTGTGTTGGGAAACAAGATTGACCTGGAAAACAGACAAGTGGCCACAAAGAGGGCACAGGCTTGGTGCTACAGCAAAAACAACATTCCTTACTTCGAGACCAGTGCCAAGGAGGCCATCAATGTGGAGCAGGCCTTCCAGACAATTGCTCGGAATGCCCTTAAACAGGAAACAGAAGTGGAACTGTACAATGAATTCCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCCGCAGAAAGCTGCAGTTGTTGAAGGGGCAGTGAGCACAGAGTCCTTCACAGACCAAGAACACACACGTAGGCCTTCAATATGCGTCCCTCCTCCTCCAAACAGACCAGAACGTGAGCTCTCACATCCAGCTGCCAAAAGAAACTCCACCGAACAGTTACCCAACACACACACATACACAAAACACACTCGTGCACACAAAAACACATACACACAACACACACACAGCAAGCAAACTCCAGCCTGTGCCTGTCAGGGCTCCTGGGGCAGCTGCCCGCCTCGTGGGCCCTGTGTATGGCAGGCATATGGCAGAGACCCTGGGTGCTCTGGGGTGCAGTGGGCATGGAAAGCTTACTCTTTTTGTCCACTGGAGAGTGAGAGAACTGTTCACAGTTCATCTGTGTCTAATTATCTGATTTTTTTTTTAACGGTCTTGTGGTCTTTTACCCCTCCCTCCTTGAAGGTCCTGTGGGAAGGCTGGTGCCCAGGCTCCGTTCTGAGCAGGCTGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAATGTATAAATTAGTGTAAGGAATTCCTGGATTGTGTGTTTAAGTCCTCTAACGCAGGCGTGCAAGGTGGAGGGTTGAACCCTGTCTGGATTACAGAGTGTTAGAGACTCAAGTTTGGAAGTCCAGCTAGCGGCAGTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCACAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCTGAAGGGAAAACTGAACTAGACAGTTCCCTTCTGTGTCTAAATTTTCCAAAAGGTTGATTTGCTTAATATAGTAGTGTATACAATGGATAAATTGCTGTTACTTCAAGAATTAAAATTCTCATTTTCTCCCTTTCTGTTTTTTTTCCTTATATTCAACACTTTATGATGCCCTTTTGTCACTATCCTACTCAAAGAGGAAAGGAGAACCCACCAGACCTGTCCCAGTGACTCTACCTTTGTTCTAGAAGGCGCTCCTTTCAGGGTTGTGGTACCTGTAGGTTAGCAGACCCTCCTCCTTTCCCACCCACCCAAGTGTGGCCCAGCACTAACCCACCGTCTCTTGGGTTGAGCCCTGGCAGTTCTGTCCCTTCCCGAGGTCCTGCCCTGCATCATGGCTTGCTTCCTGGAGCACTTCCCCTTCAGAGGTCTACATTCTAGGGTGTAGGCTGAGTTCTTCTGTAAAGAGACGAACGTGATGCCAATAAAATTTAACAAGAACAAAGAA