Transcript asmbl_25386

Sequence
Transcript Sequence for observation asmbl_25386 of TGE0000838:
AGCCCGCCTTCCTTTCCCGCAGGGTCCACACGGGTCGGGCCGGGCGCGCTCCCGTGCAGCCGGCTCCGGCCCCGACCGCCCCATGCACTCCCGGCCCCGGCGCAGGCGCAGGCGCGGGCACACGCGCCGCCGCCCGCCGGTCCTTCCCTTCGGCGGAGGTGGGGGAAGGAGGAGTCATCCCGTTTAACCCTGGGCTCCCCGAACTCTCCTTAATTTGCTAAATTTGCAGCTTGCTAATTCCTCCTGCTTTCTCCTTCCTTCCTTCTTCTGGCTCACTCCCTGCCCCGATACCAAAGTCTGGTTTATATTCAGTGCAAATTGGAGCAAACCCTACCCTTCACCTCTCTCCCGCCACCCCCCATCCTTCTGCATTGCTTTCCATCGAACTCTGCAAATTTTGCAATAGGGGGAGGGATTTTTAAAATTGCATTTGCAAAGTTCGGTGTCTGGGCTGGCGAGTGGGGGAGGGAGGGAATGGGGAGTAGGCCCCGCCCCTACCGTCCTTTGCAAATAAAAATCTAGCGGGGCGGGGGGGGGGAGGAGCAGGAAGTGGCGGTGCGAGGGCTGCTGCACAGCGAGCGGAGCCGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCGCCCGCCAGCCGAGGCAGCTCGAGCCCAGTCCGCGGCCCCAGCAGCAGCGCCGAGAGCAGCCCCAGTAGCAGCGCCATGGCCGGGTGGAACGCCTACATCGACAACCTCATGGCGGACGGGACCTGTCAGGACGCGGCCATCGTGGGCTACAAGGACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGGAAAACGTTCGTCAACATCACGCCAGCTGAGGTGGGTGTCCTGGTTGGCAAAGACCGGTCAAGTTTTTACGTGAATGGGCTGACACTTGGGGGCCAGAAATGTTCGGTGATCCGGGACTCACTGCTGCAGGATGGGGAATTTAGCATGGATCTTCGTACCAAGAGCACCGGTGGGGCCCCCACCTTCAATGTCACTGTCACCAAGACTGACAAGACGCTAGTCCTGCTGATGGGCAAAGAAGGTGTCCACGGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCCCACCTTCGGCGTTCCCAGTACTGACCTCGTCTGTCCCTTCCCCTTCACCGCTCCCCACAGCTTTGCACCCCTTTCCTCCCCATACACACACAAACCATTTTATTTTTTGGGCCATTACCCCATACCCCTTATTGCTGCCAAAACCACATGGGCTGGGGGCCAGGGCTGGATGGACAGACACCTCCCCCTACCCATATCCCTCCCGTGTGTGGTTGGAAAACTTTTGTTTTTTGGGGTTTTTTTTTTCTGAATAAAAAAGATTCTACTAACAA