Transcript asmbl_25383

Sequence
Transcript Sequence for observation asmbl_25383 of TGE0000836:
GTCATCGCGCCACGCCACCACTGGAACCCGGGGGAAGATGGCGGCAGCCGTTCTGAGTGGGCCCTCTGCGGGCTCCGCGGCTGGGGTTCCTGGCGGGACCGGGGGTCTCTCGGCAGTGAGCTCGGGCCCGCGGCTCCGCCTGCTGCTGCTGGAGAGTGTTTCTGGTTTGCTGCAACCTCGAACGGGGTCTGCCGTTGCTCCGGTGCATCCCCCAAACCGCTCGGCCCCACATTTGCCCGGGCTCATGTGCCTATTGCGGCTGCATGGGTCGGTGGGCGGGGCCCAGAACCTTTCAGCTCTTGGGGCATTGGTGAGTCTCAGTAATGCACGTCTCAGTTCCATCAAAACTCGGTTTGAGGGCCTGTGTCTGCTGTCCCTGCTGGTAGGGGAGAGCCCCACAGAGCTATTCCAGCAGCACTGTGTGTCTTGGCTTCGGAGCATTCAGCAGGTGTTACAGACCCAGGACCCGCCTGCCACAATGGAGCTGGCCGTGGCTGTCCTGAGGGACCTCCTCCGATATGCAGCCCAGCTGCCTGCACTGTTCCGGGACATCTCCATGAACCACCTCCCTGGCCTTCTCACCTCCCTGCTGGGCCTCAGGCCAGAGTGTGAGCAGTCAGCATTGGAAGGAATGAAGGCTTGTATGACCTATTTCCCTCGGGCTTGTGGTTCTCTCAAAGGCAAGCTGGCCTCATTTTTTCTGTCTAGGGTGGATGCCTTGAGCCCTCAGCTCCAACAGTTGGCCTGTGAGTGTTATTCCCGGCTGCCCTCTTTAGGGGCTGGCTTTTCCCAAGGCCTGAAGCACACCGAGAGCTGGGAGCAGGAGCTACACAGTCTGCTGGCCTCACTGCACACCCTGCTGGGGGCCCTGTACGAGGGAGCAGAGACTGCTCCTGTGCAGAATGAAGGCCCTGGGGTGGAGATGCTGCTGTCCTCAGAAGATGGTGATGCCCATGTCCTTCTCCAGCTTCGGCAGAGGTTTTCGGGACTGGCCCGCTGCCTAGGGCTCATGCTCAGCTCTGAGTTTGGAGCTCCCGTGTCCGTCCCTGTGCAGGAAATCCTGGATTTCATCTGCCGGACCCTCAGCGTCAGTAGCAAGAATATTAGCTTGCATGGAGATGGTCCCCTGCGGCTGCTGCTGCTGCCCTCTATCCACCTTGAGGCCTTGGACCTGCTGTCTGCACTCATCCTCGCGTGTGGAAGCCGGCTCTTGCGCTTTGGGATCCTGATCGGCCGCCTGCTTCCCCAGGTCCTCAATTCCTGGAGCATCGGTAGAGATTCCCTCTCTCCAGGCCAGGAGAGGCCTTACAGCACGGTTCGGACCAAGGTGTATGCGATATTAGAGCTGTGGGTGCAGGTTTGTGGGGCCTCGGCGGGAATGCTTCAGGGAGGAGCCTCTGGAGAGGCCCTGCTCACCCACCTGCTCAGCGACATCTCCCCGCCAGCTGATGCCCTTAAGCTGCGTAGCCCGCGGGGGAGCCCTGATGGGAGTTTGCAGACTGGGAAGCCTAGCGCCCCCAAGAAGCTAAAGCTGGATGTGGGGGAAGCTATGGCCCCGCCAAGCCACCGGAAAGGGGATAGCAATGCCAACAGCGACGTGTGTGCGGCTGCACTCAGAGGCCTCAGCCGGACCATCCTCATGTGTGGGCCTCTCATCAAGGAGGAGACTCACAGGAGACTGCATGACCTGGTCCTCCCCCTGGTCATGGGTGTACAGCAGGGTGAGGTCCTAGGCAGCTCCCCGTACACGAGCTCCCGCTGCCGCCGTGAACTCTACTGCCTGCTGCTGGCGCTGCTGCTGGCCCCGTCTCCTCGCTGCCCACCTCCTCTTGCCTGTGCCCTGCAAGCCTTCTCCCTCGGCCAGCGAGAAGATAGCCTTGAGGTCTCCTCTTTCTGCTCAGAAGCACTGGTGACCTGTGCTGCTCTGACCCACCCCCGGGTTCCTCCCCTGCAGCCCATGGGCCCCACCTGCCCCACACCTGCTCCAGTTCCCCCTCCTGAGGCCCCATCGCCCTTCAGGGCCCCACCGTTCCATCCTCCGGGCCCCATGCCCTCAGTGGGCTCCATGCCCTCAGCAGGCCCCATGCCTTCAGCAGGCCCCATGCCCTCAGCAGGCCCTGTGCCCTCGGCACGCCCTGGACCTCCCACCACAGCCAACCACCTAGGCCTTTCTGTCCCAGGCCTAGTGTCTGTCCCTCCCCGGCTTCTTCCTGGCCCTGAGAACCACCGGGCAGGCTCAAATGAGGACCCCATCCTTGCCCCTAGTGGGACTCCCCCACCTACTATACCCCCAGATGAAACTTTTGGGGGGAGAGTGCCCAGACCAGCCTTTGTCCACTATGACAAGGAGGAGGCATCTGATGTGGAGATCTCCTTGGAAAGTGACTCTGATGACAGCGTGGTGATCGTGCCCGAGGGGCTTCCCCCCCTGCCACCCCCACCACCCTCAGGTGCCACACCACCCCCTATAGCCCCCACTGGGCCACCAACAGCCTCCCCTCCTGTGCCAGCGAAGGAGGAGCCTGAAGAACTTCCTGCAGCCCCAGGGCCTCTCCCGCCACCCCCACCTCCGCCGCCGCCTGTTCCTGGTCCTGTGACGCTCCCTCCACCCCAGTTGGTCCCTGAAGGGACTCCTGGTGGGGGAGGACCCCCAGCCCTGGAAGAGGATTTGACAGTTATTAATATCAACAGCAGTGATGAAGAGGAGGAGGAAGAGGAAGA