Transcript asmbl_13732

Sequence
Transcript Sequence for observation asmbl_13732 of TGE0003105:
GGGCTCAGGCGCAGGCTACGAAAAGTGACGCAAGCAGCGGCGACACTGGTGGTATTGACGCCATTTGCTTCACTCGGAGGTAGATTCTTGCTAATTGTCCTAGAGTCCGTATTAATATCGTTCCGGGTCTGCGATCTGTAATTCCTTTATCTCACTGGCCTCTCGGAGAAGTCGCCGTTGCGAAGGCACCACCAGATAAGAGTAGGAGACGCCATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGGCGTAGAGGTAAGAATGAGAATGAATCTGAAAAAAGAGAATTGGTCTTTAAAGAGGATGGGCAAGAGTATGCTCAAGTAATCAAAATGTTGGGAAATGGACGATTAGAAGCAATGTGCTTCGATGGTGTAAAGAGGTTATGTCATATCAGAGGAAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGACATTATATTGGTTGGTCTACGAGATTATCAGGATAACAAAGCGGATGTAATTTTAAAATATAATGCAGATGAAGCTAGAAGTCTGAAGGCATATGGCGAGCTTCCAGAACATGCTAAAATCAATGAAACAGATACATTCGGTCCTGGAGATGATGATGAAATTCAGTTTGATGATATTGGAGATGATGATGAAGACATTGATGATATCTAAATTGAACTCAAAGTTTCTGAGTATTGCTCTACGATTTGGATTTTGGCCATCACCTGTTAAGAAGACCAAAACTTCATTAAACATGAATGCAGTTTGTTAGGACACACTGATTTATTTCATTGTTTAAAGTATTTATTATATTTCTTTAAAAACCGCCAAAGCTGAATTATCTTAAGTGAAATGTTAACAATTTATTCTTTTGATGTAATAGAACTTAGTGGTAGACCACAGTATCTGTTATTTAAAATAGTAGGAGAAAGTATATTAATAAAAGAAGGCTTTAATGGATATTTTTAATAAATTGCTTTATCATAGACTGCGTTAAGCCCTAGGGCCAACTAGTCTGTTTAGAAACTCTTTCTATATGTTCCAGTTACCTAGATGTTCTCTTGAGATTTTAGTTTAAATTTAAGGAAGGCAGAAATCTACATCTGAAGTCAAGAAAAGGGGCTATTTTCATATTTATGTAGCTGTATGTATTTTTATACTGTTTGATAACATTCTTTTCATCATTTTATGTTGTCACCATCAAAAAAAGCATTTCAAAATACAGCTTTTAGAACATGAGTTTGAGTAGTAATTTTGAATTTGTAAGATTTGTAGTGGCAAAAATTCAATGCTAATAATTAATGCCCAATTATCTTAATATTGGAAATATTGATATATTAGTTGATAGTGTTTTTCACTTAATATGTGGAAATTTTCTTAAGTAAGACAACTTTTAATGGC